Incidental Mutation 'R6004:Vps39'
ID478496
Institutional Source Beutler Lab
Gene Symbol Vps39
Ensembl Gene ENSMUSG00000027291
Gene NameVPS39 HOPS complex subunit
SynonymsmVam6, Vam6P, Vam6, A230065P22Rik
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.879) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location120316461-120353137 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 120345650 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 83 (V83A)
Ref Sequence ENSEMBL: ENSMUSP00000099559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028752] [ENSMUST00000102501]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028752
AA Change: V72A

PolyPhen 2 Score 0.867 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000028752
Gene: ENSMUSG00000027291
AA Change: V72A

DomainStartEndE-ValueType
Pfam:CNH 19 280 8.3e-53 PFAM
Pfam:Clathrin 410 536 3.9e-9 PFAM
Pfam:Vps39_1 449 551 1.7e-35 PFAM
Pfam:Clathrin 570 740 2.3e-8 PFAM
Pfam:Vps39_2 761 869 5.1e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102501
AA Change: V83A

PolyPhen 2 Score 0.890 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099559
Gene: ENSMUSG00000027291
AA Change: V83A

DomainStartEndE-ValueType
Pfam:CNH 20 291 1.3e-32 PFAM
Pfam:Clathrin 421 547 2e-9 PFAM
Pfam:Vps39_1 460 562 6.7e-36 PFAM
Pfam:Clathrin 582 751 2.3e-8 PFAM
Pfam:Vps39_2 772 880 6.6e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126526
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138854
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156296
Meta Mutation Damage Score 0.3814 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may promote clustering and fusion of late endosomes and lysosomes. The protein may also act as an adaptor protein that modulates the transforming growth factor-beta response by coupling the transforming growth factor-beta receptor complex to the Smad pathway. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Vps39
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01393:Vps39 APN 2 120350238 splice site probably benign
IGL01629:Vps39 APN 2 120323598 missense probably benign 0.11
IGL01812:Vps39 APN 2 120320790 splice site probably benign
IGL01936:Vps39 APN 2 120323128 missense probably benign 0.23
IGL02379:Vps39 APN 2 120323608 missense probably benign 0.17
IGL02892:Vps39 APN 2 120323171 splice site probably benign
IGL02943:Vps39 APN 2 120339487 missense possibly damaging 0.77
R0001:Vps39 UTSW 2 120318053 missense probably benign 0.09
R0329:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0330:Vps39 UTSW 2 120338787 missense possibly damaging 0.89
R0364:Vps39 UTSW 2 120345638 missense probably damaging 1.00
R1483:Vps39 UTSW 2 120323648 missense probably damaging 1.00
R1625:Vps39 UTSW 2 120323625 missense probably damaging 1.00
R1837:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1839:Vps39 UTSW 2 120325397 missense probably damaging 1.00
R1934:Vps39 UTSW 2 120318077 missense probably damaging 1.00
R2018:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2019:Vps39 UTSW 2 120343227 missense probably damaging 1.00
R2178:Vps39 UTSW 2 120323679 nonsense probably null
R2513:Vps39 UTSW 2 120338787 missense probably damaging 1.00
R3771:Vps39 UTSW 2 120342016 missense possibly damaging 0.85
R3952:Vps39 UTSW 2 120350175 missense probably benign 0.15
R4580:Vps39 UTSW 2 120339333 missense probably benign 0.35
R4815:Vps39 UTSW 2 120338559 missense probably benign 0.37
R4851:Vps39 UTSW 2 120321831 intron probably benign
R4894:Vps39 UTSW 2 120352959 missense probably damaging 1.00
R5447:Vps39 UTSW 2 120352932 missense probably benign 0.43
R5483:Vps39 UTSW 2 120323083 missense probably benign 0.08
R5715:Vps39 UTSW 2 120325236 missense possibly damaging 0.73
R5886:Vps39 UTSW 2 120321572 intron probably benign
R5949:Vps39 UTSW 2 120328668 missense probably benign 0.23
R5954:Vps39 UTSW 2 120324662 missense probably damaging 1.00
R5973:Vps39 UTSW 2 120328705 missense probably damaging 0.99
R6208:Vps39 UTSW 2 120333416 missense probably damaging 0.98
R6705:Vps39 UTSW 2 120320676 missense probably benign 0.00
R6915:Vps39 UTSW 2 120321031 nonsense probably null
R7535:Vps39 UTSW 2 120324695 missense probably damaging 1.00
R7780:Vps39 UTSW 2 120325199 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCACTTTCTGAATTTCGGCATGATG -3'
(R):5'- GGTCAAGTGCCCGAATCTTC -3'

Sequencing Primer
(F):5'- TCGGCATGATGATCACTAAACAG -3'
(R):5'- GTGCCCGAATCTTCTGTCACAAG -3'
Posted On2017-06-26