Incidental Mutation 'R6004:Stag3'
ID478504
Institutional Source Beutler Lab
Gene Symbol Stag3
Ensembl Gene ENSMUSG00000036928
Gene Namestromal antigen 3
SynonymsSA-2, stromalin 3
MMRRC Submission 044182-MU
Accession Numbers

Ncbi RefSeq: NM_016964.2; MGI:1355311

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location138280240-138312393 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138289206 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 131 (D131V)
Ref Sequence ENSEMBL: ENSMUSP00000125523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048028] [ENSMUST00000160729] [ENSMUST00000161691] [ENSMUST00000162245]
Predicted Effect probably damaging
Transcript: ENSMUST00000048028
AA Change: D131V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000040945
Gene: ENSMUSG00000036928
AA Change: D131V

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 188 301 3.1e-38 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159483
Predicted Effect probably damaging
Transcript: ENSMUST00000160729
AA Change: D131V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124170
Gene: ENSMUSG00000036928
AA Change: D131V

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161113
Predicted Effect probably damaging
Transcript: ENSMUST00000161691
AA Change: D100V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125290
Gene: ENSMUSG00000036928
AA Change: D100V

DomainStartEndE-ValueType
low complexity region 44 59 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000162245
AA Change: D131V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125523
Gene: ENSMUSG00000036928
AA Change: D131V

DomainStartEndE-ValueType
low complexity region 6 26 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
Pfam:STAG 185 304 4e-50 PFAM
low complexity region 633 653 N/A INTRINSIC
low complexity region 1099 1114 N/A INTRINSIC
low complexity region 1141 1151 N/A INTRINSIC
low complexity region 1190 1208 N/A INTRINSIC
Meta Mutation Damage Score 0.8781 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype Strain: 5287255
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is expressed in the nucleus and is a subunit of the cohesin complex which regulates the cohesion of sister chromatids during cell division. A mutation in this gene is associated with premature ovarian failure. Alternate splicing results in multiple transcript variants encoding distinct isoforms. This gene has multiple pseudogenes. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit azoospermia and lack oocytes. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(2) Gene trapped(1) Transgenic(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Stag3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Stag3 APN 5 138299138 missense probably damaging 1.00
IGL00336:Stag3 APN 5 138297659 missense probably benign 0.42
IGL00514:Stag3 APN 5 138300135 missense probably damaging 1.00
IGL00961:Stag3 APN 5 138298349 missense probably benign 0.01
IGL01923:Stag3 APN 5 138289230 missense probably damaging 1.00
IGL02252:Stag3 APN 5 138302548 missense probably damaging 1.00
IGL02424:Stag3 APN 5 138281985 nonsense probably null
IGL02424:Stag3 APN 5 138291366 missense probably damaging 1.00
IGL02869:Stag3 APN 5 138282693 missense probably damaging 0.96
thor UTSW 5 138301036 critical splice donor site probably null
R0016:Stag3 UTSW 5 138291381 missense possibly damaging 0.50
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0038:Stag3 UTSW 5 138301036 critical splice donor site probably null
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R0046:Stag3 UTSW 5 138283023 splice site probably benign
R1455:Stag3 UTSW 5 138311735 missense probably benign 0.00
R1512:Stag3 UTSW 5 138297985 missense probably benign 0.32
R1530:Stag3 UTSW 5 138297412 missense probably damaging 0.99
R1608:Stag3 UTSW 5 138298639 intron probably null
R1736:Stag3 UTSW 5 138304509 splice site probably benign
R1969:Stag3 UTSW 5 138300138 missense probably damaging 0.99
R2034:Stag3 UTSW 5 138298001 missense possibly damaging 0.82
R2214:Stag3 UTSW 5 138301266 missense possibly damaging 0.92
R2281:Stag3 UTSW 5 138298284 missense probably damaging 1.00
R2411:Stag3 UTSW 5 138283028 splice site probably benign
R3792:Stag3 UTSW 5 138298349 missense probably benign 0.01
R3887:Stag3 UTSW 5 138298839 missense probably damaging 0.99
R4255:Stag3 UTSW 5 138290881 missense probably damaging 0.98
R4777:Stag3 UTSW 5 138309199 unclassified probably benign
R4842:Stag3 UTSW 5 138309365 intron probably null
R4854:Stag3 UTSW 5 138296694 splice site probably null
R5045:Stag3 UTSW 5 138304478 missense probably damaging 1.00
R5631:Stag3 UTSW 5 138295877 missense probably damaging 0.96
R5729:Stag3 UTSW 5 138290223 missense possibly damaging 0.76
R5894:Stag3 UTSW 5 138298838 missense probably damaging 0.99
R6172:Stag3 UTSW 5 138299843 missense probably benign 0.41
R6503:Stag3 UTSW 5 138304420 missense probably damaging 0.96
R6545:Stag3 UTSW 5 138298352 missense possibly damaging 0.84
R6736:Stag3 UTSW 5 138301499 missense probably damaging 0.98
R6861:Stag3 UTSW 5 138304707 missense possibly damaging 0.55
R7012:Stag3 UTSW 5 138297609 splice site probably null
R7358:Stag3 UTSW 5 138301508 missense probably damaging 1.00
R7378:Stag3 UTSW 5 138281960 missense probably benign 0.00
R7392:Stag3 UTSW 5 138291366 missense probably damaging 1.00
R7395:Stag3 UTSW 5 138281945 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- GTCAACTTCCTACTTCCTAAAATGGC -3'
(R):5'- AATACTCCAGCTCTTCACGC -3'

Sequencing Primer
(F):5'- ACTTCCTAAAATGGCTACCATCTC -3'
(R):5'- AATACTCCAGCTCTTCACGCCTTAC -3'
Posted On2017-06-26