Incidental Mutation 'R6004:Itgax'
ID478511
Institutional Source Beutler Lab
Gene Symbol Itgax
Ensembl Gene ENSMUSG00000030789
Gene Nameintegrin alpha X
SynonymsCd11c, CD11C (p150) alpha polypeptide
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128129547-128150657 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 128131452 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 114 (H114L)
Ref Sequence ENSEMBL: ENSMUSP00000033053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033053] [ENSMUST00000098015] [ENSMUST00000205460]
Predicted Effect probably damaging
Transcript: ENSMUST00000033053
AA Change: H114L

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000033053
Gene: ENSMUSG00000030789
AA Change: H114L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Int_alpha 33 83 1.28e1 SMART
VWA 150 331 8.36e-43 SMART
Int_alpha 402 451 3.67e-3 SMART
Int_alpha 455 512 1.29e-7 SMART
Int_alpha 518 574 5.72e-14 SMART
Int_alpha 581 635 1.55e-1 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 6.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134694
SMART Domains Protein: ENSMUSP00000117120
Gene: ENSMUSG00000108596

DomainStartEndE-ValueType
Pfam:Ribosomal_L29 39 82 1.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205408
Predicted Effect probably benign
Transcript: ENSMUST00000205460
AA Change: H114L

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205866
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the integrin alpha X chain protein. Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This protein combines with the beta 2 chain (ITGB2) to form a leukocyte-specific integrin referred to as inactivated-C3b (iC3b) receptor 4 (CR4). The alpha X beta 2 complex seems to overlap the properties of the alpha M beta 2 integrin in the adherence of neutrophils and monocytes to stimulated endothelium cells, and in the phagocytosis of complement coated particles. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susceptibility to bacterial infection, decreased susceptibility to experimental autoimmune encephalomyelitis (EAE), increased T cell proliferation, and an abnormal pattern of cytokine production during EAE. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Itgax
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Itgax APN 7 128135326 missense probably damaging 1.00
IGL00325:Itgax APN 7 128148309 missense possibly damaging 0.69
IGL01155:Itgax APN 7 128145035 missense probably benign 0.00
IGL01461:Itgax APN 7 128135018 missense probably damaging 1.00
IGL01508:Itgax APN 7 128144818 missense probably damaging 1.00
IGL01549:Itgax APN 7 128131206 splice site probably null
IGL01864:Itgax APN 7 128133763 missense probably benign 0.00
IGL02094:Itgax APN 7 128131473 missense probably damaging 1.00
IGL02364:Itgax APN 7 128139982 missense possibly damaging 0.89
IGL02969:Itgax APN 7 128149123 missense probably benign
IGL03406:Itgax APN 7 128149198 missense possibly damaging 0.93
Adendritic UTSW 7 128148572 nonsense probably null
PIT4651001:Itgax UTSW 7 128149110 missense probably benign 0.11
R0366:Itgax UTSW 7 128149089 splice site probably benign
R0763:Itgax UTSW 7 128147940 splice site probably benign
R1072:Itgax UTSW 7 128150144 missense probably damaging 0.96
R1659:Itgax UTSW 7 128130891 missense probably benign 0.15
R2019:Itgax UTSW 7 128148526 missense probably benign
R2418:Itgax UTSW 7 128142333 missense probably damaging 0.98
R3027:Itgax UTSW 7 128148572 nonsense probably null
R3846:Itgax UTSW 7 128133767 missense probably damaging 1.00
R3938:Itgax UTSW 7 128136273 missense possibly damaging 0.73
R4021:Itgax UTSW 7 128133139 critical splice donor site probably null
R4027:Itgax UTSW 7 128141266 missense possibly damaging 0.75
R4163:Itgax UTSW 7 128144700 missense probably benign 0.00
R4923:Itgax UTSW 7 128148528 missense probably benign
R5259:Itgax UTSW 7 128148278 missense probably damaging 0.99
R5333:Itgax UTSW 7 128142283 missense probably damaging 1.00
R5347:Itgax UTSW 7 128141302 missense probably benign 0.08
R5679:Itgax UTSW 7 128134990 missense probably benign 0.00
R5725:Itgax UTSW 7 128147861 missense possibly damaging 0.63
R5733:Itgax UTSW 7 128140475 missense probably damaging 0.99
R5750:Itgax UTSW 7 128144706 missense probably benign 0.32
R5964:Itgax UTSW 7 128140447 missense probably damaging 1.00
R6168:Itgax UTSW 7 128133097 missense probably damaging 0.99
R6212:Itgax UTSW 7 128130332 missense possibly damaging 0.52
R6212:Itgax UTSW 7 128147853 missense probably benign 0.16
R6480:Itgax UTSW 7 128148599 missense probably benign 0.12
R6484:Itgax UTSW 7 128133718 missense probably benign 0.13
R6796:Itgax UTSW 7 128135064 missense probably damaging 1.00
R6844:Itgax UTSW 7 128147934 splice site probably null
R7287:Itgax UTSW 7 128148505 missense probably damaging 1.00
R7365:Itgax UTSW 7 128135309 missense probably damaging 1.00
R7421:Itgax UTSW 7 128140432 missense probably damaging 1.00
X0061:Itgax UTSW 7 128129607 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGAACATATCCCTGGGCCTG -3'
(R):5'- TCCCTTTTGGAAAAGAATCTGACCC -3'

Sequencing Primer
(F):5'- AACCCTTCCTGGCTGTTGGTG -3'
(R):5'- TGGAAAAGAATCTGACCCACCGAAG -3'
Posted On2017-06-26