Incidental Mutation 'R6004:Olfr792'
ID478523
Institutional Source Beutler Lab
Gene Symbol Olfr792
Ensembl Gene ENSMUSG00000094496
Gene Nameolfactory receptor 792
SynonymsGA_x6K02T2PULF-11219415-11220350, MOR108-2
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129539162-129542534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129540890 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 118 (Y118N)
Ref Sequence ENSEMBL: ENSMUSP00000149872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076575] [ENSMUST00000215436]
Predicted Effect probably benign
Transcript: ENSMUST00000076575
AA Change: Y118N

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000096707
Gene: ENSMUSG00000094496
AA Change: Y118N

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.9e-53 PFAM
Pfam:7tm_1 39 288 4.7e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215436
AA Change: Y118N

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Olfr792
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Olfr792 APN 10 129540842 missense probably benign 0.07
IGL01459:Olfr792 APN 10 129540541 start codon destroyed probably null 1.00
IGL02090:Olfr792 APN 10 129541307 missense probably damaging 1.00
IGL03338:Olfr792 APN 10 129541056 missense probably damaging 0.99
R0382:Olfr792 UTSW 10 129541014 missense probably benign 0.01
R1672:Olfr792 UTSW 10 129540692 missense probably benign 0.00
R2285:Olfr792 UTSW 10 129540668 missense probably benign 0.22
R2938:Olfr792 UTSW 10 129540615 missense probably damaging 1.00
R3498:Olfr792 UTSW 10 129540909 missense probably damaging 1.00
R5309:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R5312:Olfr792 UTSW 10 129541265 missense probably benign 0.01
R6800:Olfr792 UTSW 10 129541263 missense probably damaging 1.00
R7127:Olfr792 UTSW 10 129541067 missense probably damaging 1.00
R7167:Olfr792 UTSW 10 129540738 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTGATAGATTCACACCTCAAGAC -3'
(R):5'- CTGTGCAAGAGATGAGCAGC -3'

Sequencing Primer
(F):5'- TAGATTCACACCTCAAGACACCCATG -3'
(R):5'- TCACAGGTGAAATGGTCAATAATG -3'
Posted On2017-06-26