Incidental Mutation 'R6004:Lrrc37a'
ID478526
Institutional Source Beutler Lab
Gene Symbol Lrrc37a
Ensembl Gene ENSMUSG00000078632
Gene Nameleucine rich repeat containing 37A
SynonymsLOC237954
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location103451955-103504597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103502536 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 688 (V688M)
Ref Sequence ENSEMBL: ENSMUSP00000121903 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000153273]
Predicted Effect possibly damaging
Transcript: ENSMUST00000153273
AA Change: V688M

PolyPhen 2 Score 0.558 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000121903
Gene: ENSMUSG00000078632
AA Change: V688M

DomainStartEndE-ValueType
Pfam:LRRC37 199 269 2.6e-15 PFAM
low complexity region 313 329 N/A INTRINSIC
Pfam:LRRC37 363 432 4e-18 PFAM
low complexity region 457 467 N/A INTRINSIC
low complexity region 480 492 N/A INTRINSIC
Pfam:LRRC37 550 619 2.1e-21 PFAM
Pfam:LRRC37 637 704 2.9e-12 PFAM
Pfam:LRRC37 780 851 2.5e-12 PFAM
Pfam:LRRC37 1078 1148 2.7e-18 PFAM
Pfam:LRRC37 1149 1190 2.1e-7 PFAM
Pfam:LRRC37 1187 1258 2.5e-25 PFAM
Pfam:LRRC37 1255 1300 2.6e-7 PFAM
Pfam:LRRC37 1299 1370 2.4e-27 PFAM
Pfam:LRRC37 1369 1420 2.9e-8 PFAM
Pfam:LRRC37 1419 1488 1.3e-24 PFAM
Pfam:LRRC37 1509 1578 9.2e-21 PFAM
Pfam:LRRC37 1575 1620 1.7e-6 PFAM
Pfam:LRRC37 1619 1686 1.7e-20 PFAM
Pfam:LRRC37 1690 1736 7e-10 PFAM
Pfam:LRRC37 1733 1799 7.5e-17 PFAM
Pfam:LRRC37 1789 1854 5.1e-12 PFAM
Pfam:LRRC37 1850 1921 4.2e-21 PFAM
Pfam:LRRC37 1915 1969 1.1e-9 PFAM
low complexity region 2143 2167 N/A INTRINSIC
low complexity region 2185 2209 N/A INTRINSIC
low complexity region 2228 2249 N/A INTRINSIC
low complexity region 2262 2274 N/A INTRINSIC
low complexity region 2284 2297 N/A INTRINSIC
LRR 2419 2438 3.09e1 SMART
LRR 2439 2462 9.96e-1 SMART
LRR 2463 2486 8.24e0 SMART
LRR 2490 2514 3.18e1 SMART
low complexity region 2535 2547 N/A INTRINSIC
coiled coil region 2712 2735 N/A INTRINSIC
low complexity region 2861 2871 N/A INTRINSIC
low complexity region 2937 2950 N/A INTRINSIC
Pfam:LRRC37AB_C 3063 3209 1.1e-77 PFAM
Meta Mutation Damage Score 0.0802 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Lrrc37a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Lrrc37a APN 11 103500351 missense probably benign 0.09
IGL01339:Lrrc37a APN 11 103497937 missense unknown
IGL01352:Lrrc37a APN 11 103499355 missense probably benign 0.39
IGL01382:Lrrc37a APN 11 103498755 missense probably damaging 0.99
IGL01395:Lrrc37a APN 11 103503861 missense probably benign 0.24
IGL01645:Lrrc37a APN 11 103504264 missense probably benign 0.01
IGL01925:Lrrc37a APN 11 103498419 missense probably benign 0.01
IGL02006:Lrrc37a APN 11 103456491 missense probably damaging 1.00
IGL02127:Lrrc37a APN 11 103504539 missense probably benign 0.01
IGL02184:Lrrc37a APN 11 103497609 missense unknown
IGL02218:Lrrc37a APN 11 103500381 missense probably benign 0.03
IGL02436:Lrrc37a APN 11 103498177 missense unknown
IGL02487:Lrrc37a APN 11 103496037 missense unknown
IGL02597:Lrrc37a APN 11 103504287 missense probably benign 0.01
IGL02634:Lrrc37a APN 11 103499112 missense probably benign 0.09
IGL02818:Lrrc37a APN 11 103501306 missense possibly damaging 0.47
IGL02829:Lrrc37a APN 11 103491174 missense unknown
IGL02987:Lrrc37a APN 11 103500413 missense probably benign 0.03
IGL03081:Lrrc37a APN 11 103456595 missense unknown
IGL03210:Lrrc37a APN 11 103499505 missense probably benign 0.29
IGL03239:Lrrc37a APN 11 103499407 missense probably benign 0.03
IGL03285:Lrrc37a APN 11 103497673 missense unknown
IGL03296:Lrrc37a APN 11 103497673 missense unknown
IGL03299:Lrrc37a APN 11 103497673 missense unknown
IGL03370:Lrrc37a APN 11 103497673 missense unknown
IGL03390:Lrrc37a APN 11 103496031 missense unknown
F5770:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
P0035:Lrrc37a UTSW 11 103503132 missense possibly damaging 0.84
PIT4458001:Lrrc37a UTSW 11 103504512 missense probably benign 0.04
R0112:Lrrc37a UTSW 11 103500913 missense probably benign 0.19
R0194:Lrrc37a UTSW 11 103499790 missense possibly damaging 0.82
R0360:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0364:Lrrc37a UTSW 11 103500640 missense possibly damaging 0.89
R0395:Lrrc37a UTSW 11 103464395 missense unknown
R0418:Lrrc37a UTSW 11 103503438 missense probably benign 0.03
R0505:Lrrc37a UTSW 11 103503025 missense probably benign 0.10
R0583:Lrrc37a UTSW 11 103498437 missense probably benign 0.01
R1078:Lrrc37a UTSW 11 103497631 missense unknown
R1581:Lrrc37a UTSW 11 103457017 nonsense probably null
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1888:Lrrc37a UTSW 11 103498761 missense probably benign 0.18
R1907:Lrrc37a UTSW 11 103457156 missense unknown
R1982:Lrrc37a UTSW 11 103498966 missense probably benign 0.20
R1991:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2017:Lrrc37a UTSW 11 103501125 missense probably benign 0.03
R2103:Lrrc37a UTSW 11 103500261 missense probably benign 0.29
R2110:Lrrc37a UTSW 11 103497822 missense unknown
R2190:Lrrc37a UTSW 11 103500043 missense possibly damaging 0.82
R2252:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2253:Lrrc37a UTSW 11 103501467 missense probably benign 0.01
R2894:Lrrc37a UTSW 11 103497864 missense unknown
R2899:Lrrc37a UTSW 11 103497864 missense unknown
R3439:Lrrc37a UTSW 11 103497864 missense unknown
R3899:Lrrc37a UTSW 11 103497546 missense unknown
R3916:Lrrc37a UTSW 11 103455518 missense possibly damaging 0.83
R3921:Lrrc37a UTSW 11 103501470 missense probably benign 0.10
R3977:Lrrc37a UTSW 11 103457604 missense unknown
R4043:Lrrc37a UTSW 11 103498653 missense possibly damaging 0.95
R4077:Lrrc37a UTSW 11 103497982 missense unknown
R4237:Lrrc37a UTSW 11 103502289 missense probably damaging 0.97
R4461:Lrrc37a UTSW 11 103464354 critical splice donor site probably null
R4498:Lrrc37a UTSW 11 103501798 missense probably benign 0.20
R4593:Lrrc37a UTSW 11 103498969 missense possibly damaging 0.64
R4670:Lrrc37a UTSW 11 103504537 missense probably benign 0.10
R4698:Lrrc37a UTSW 11 103504104 missense possibly damaging 0.83
R4750:Lrrc37a UTSW 11 103455480 missense probably benign 0.24
R4805:Lrrc37a UTSW 11 103504309 missense probably benign 0.01
R4940:Lrrc37a UTSW 11 103497612 missense unknown
R4983:Lrrc37a UTSW 11 103497618 missense unknown
R4989:Lrrc37a UTSW 11 103456739 missense unknown
R5046:Lrrc37a UTSW 11 103498240 missense unknown
R5217:Lrrc37a UTSW 11 103456954 missense unknown
R5300:Lrrc37a UTSW 11 103456958 missense unknown
R5509:Lrrc37a UTSW 11 103500535 missense probably benign 0.23
R5550:Lrrc37a UTSW 11 103498177 missense unknown
R5655:Lrrc37a UTSW 11 103498555 missense probably benign 0.28
R5668:Lrrc37a UTSW 11 103500175 missense probably benign 0.03
R5750:Lrrc37a UTSW 11 103458097 missense unknown
R5815:Lrrc37a UTSW 11 103503786 missense probably benign 0.01
R5976:Lrrc37a UTSW 11 103499071 missense possibly damaging 0.73
R5990:Lrrc37a UTSW 11 103500958 missense probably benign 0.19
R6019:Lrrc37a UTSW 11 103456596 missense unknown
R6056:Lrrc37a UTSW 11 103497658 missense unknown
R6125:Lrrc37a UTSW 11 103501560 missense probably benign 0.19
R6190:Lrrc37a UTSW 11 103501216 missense possibly damaging 0.67
R6295:Lrrc37a UTSW 11 103497633 missense unknown
R6320:Lrrc37a UTSW 11 103504051 missense probably benign 0.10
R6354:Lrrc37a UTSW 11 103464387 missense unknown
R6375:Lrrc37a UTSW 11 103501089 missense probably benign 0.19
R6406:Lrrc37a UTSW 11 103497535 missense unknown
R6468:Lrrc37a UTSW 11 103460840 missense unknown
R6490:Lrrc37a UTSW 11 103456660 missense unknown
R6502:Lrrc37a UTSW 11 103492179 missense unknown
R6509:Lrrc37a UTSW 11 103504414 missense probably benign 0.04
R6749:Lrrc37a UTSW 11 103502097 missense probably benign 0.29
R6768:Lrrc37a UTSW 11 103500123 missense probably benign 0.36
R6912:Lrrc37a UTSW 11 103457543 missense unknown
R7081:Lrrc37a UTSW 11 103457955 missense unknown
R7083:Lrrc37a UTSW 11 103503340 missense probably benign 0.03
R7154:Lrrc37a UTSW 11 103502856 missense probably benign 0.03
R7195:Lrrc37a UTSW 11 103457775 missense unknown
R7265:Lrrc37a UTSW 11 103498941 missense probably benign 0.09
R7276:Lrrc37a UTSW 11 103456746 missense unknown
R7362:Lrrc37a UTSW 11 103457509 missense unknown
R7450:Lrrc37a UTSW 11 103498326 missense probably benign 0.01
R7458:Lrrc37a UTSW 11 103497432 missense unknown
R7487:Lrrc37a UTSW 11 103498219 missense unknown
R7535:Lrrc37a UTSW 11 103501857 missense possibly damaging 0.68
R7593:Lrrc37a UTSW 11 103500952 missense probably benign 0.03
V7580:Lrrc37a UTSW 11 103455512 missense possibly damaging 0.95
X0018:Lrrc37a UTSW 11 103499544 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGGAGCCTCCTCTTGATTTG -3'
(R):5'- AGTCTTCTCTAGCCCAGCAG -3'

Sequencing Primer
(F):5'- GGAGCCTCCTCTTGATTTGACAAG -3'
(R):5'- CGGTGCATCCTTCAGAGTATACTG -3'
Posted On2017-06-26