Incidental Mutation 'R6004:Ighv14-2'
ID478529
Institutional Source Beutler Lab
Gene Symbol Ighv14-2
Ensembl Gene ENSMUSG00000095583
Gene Nameimmunoglobulin heavy variable 14-2
SynonymsGm16683
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.282) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113994469-113994898 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 113994635 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 62 (Q62L)
Ref Sequence ENSEMBL: ENSMUSP00000100248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103467]
Predicted Effect probably damaging
Transcript: ENSMUST00000103467
AA Change: Q62L

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000100248
Gene: ENSMUSG00000095583
AA Change: Q62L

DomainStartEndE-ValueType
IGv 36 117 5.95e-29 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Ighv14-2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ighv14-2 APN 12 113994759 missense possibly damaging 0.47
IGL01685:Ighv14-2 APN 12 113994501 missense probably damaging 0.99
IGL02994:Ighv14-2 APN 12 113994591 missense probably benign 0.10
IGL03222:Ighv14-2 APN 12 113994494 missense possibly damaging 0.94
R4537:Ighv14-2 UTSW 12 113994892 missense probably benign 0.27
R6294:Ighv14-2 UTSW 12 113994598 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGGTTCTATGGTTTCTGACACAC -3'
(R):5'- GGCCATACACTCTGTGACAG -3'

Sequencing Primer
(F):5'- CACTCAGGATGTGGTTGCAACAC -3'
(R):5'- CACTCTGTGACAGTGGTAATCAC -3'
Posted On2017-06-26