Incidental Mutation 'R6004:Zfp712'
ID478532
Institutional Source Beutler Lab
Gene Symbol Zfp712
Ensembl Gene ENSMUSG00000090641
Gene Namezinc finger protein 712
Synonyms4921504N20Rik, mszf31, mszf89
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location67038596-67061170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 67041705 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 253 (C253R)
Ref Sequence ENSEMBL: ENSMUSP00000126665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167565]
Predicted Effect probably damaging
Transcript: ENSMUST00000167565
AA Change: C253R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126665
Gene: ENSMUSG00000090641
AA Change: C253R

DomainStartEndE-ValueType
KRAB 5 65 7.38e-36 SMART
ZnF_C2H2 109 131 1.28e-3 SMART
ZnF_C2H2 137 159 4.17e-3 SMART
ZnF_C2H2 165 186 1.73e0 SMART
ZnF_C2H2 192 214 3.39e-3 SMART
ZnF_C2H2 220 242 1.58e-3 SMART
ZnF_C2H2 248 270 8.34e-3 SMART
ZnF_C2H2 276 298 4.17e-3 SMART
ZnF_C2H2 304 326 4.87e-4 SMART
ZnF_C2H2 332 354 1.04e-3 SMART
ZnF_C2H2 360 382 5.5e-3 SMART
ZnF_C2H2 388 410 1.89e-1 SMART
ZnF_C2H2 416 438 7.15e-2 SMART
ZnF_C2H2 444 466 3.58e-2 SMART
ZnF_C2H2 472 494 5.99e-4 SMART
ZnF_C2H2 500 522 2.12e-4 SMART
ZnF_C2H2 528 550 3.83e-2 SMART
ZnF_C2H2 556 578 2.95e-3 SMART
ZnF_C2H2 584 606 6.32e-3 SMART
ZnF_C2H2 612 634 3.89e-3 SMART
ZnF_C2H2 640 662 3.49e-5 SMART
ZnF_C2H2 668 690 1.84e-4 SMART
Meta Mutation Damage Score 0.8193 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Zfp712
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01407:Zfp712 APN 13 67042166 missense possibly damaging 0.55
IGL02148:Zfp712 APN 13 67042158 missense probably damaging 1.00
R0085:Zfp712 UTSW 13 67041192 missense probably benign 0.00
R0332:Zfp712 UTSW 13 67040813 missense probably damaging 1.00
R1676:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R1838:Zfp712 UTSW 13 67042047 missense probably damaging 1.00
R1997:Zfp712 UTSW 13 67042050 nonsense probably null
R2147:Zfp712 UTSW 13 67041896 missense possibly damaging 0.94
R2203:Zfp712 UTSW 13 67041984 missense probably benign 0.32
R3421:Zfp712 UTSW 13 67052392 missense probably damaging 0.98
R3943:Zfp712 UTSW 13 67041332 missense probably benign 0.06
R4722:Zfp712 UTSW 13 67042113 missense probably benign 0.41
R4952:Zfp712 UTSW 13 67040841 missense possibly damaging 0.63
R4964:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4966:Zfp712 UTSW 13 67040612 missense probably damaging 1.00
R4967:Zfp712 UTSW 13 67040709 nonsense probably null
R5114:Zfp712 UTSW 13 67041361 missense probably damaging 1.00
R5361:Zfp712 UTSW 13 67041015 missense possibly damaging 0.95
R5922:Zfp712 UTSW 13 67041604 missense probably benign 0.01
R5950:Zfp712 UTSW 13 67044817 missense probably damaging 0.99
R6236:Zfp712 UTSW 13 67040621 missense probably damaging 1.00
R6298:Zfp712 UTSW 13 67041329 missense probably damaging 1.00
R6499:Zfp712 UTSW 13 67052336 missense probably benign 0.00
R6774:Zfp712 UTSW 13 67041504 missense probably benign 0.01
R6932:Zfp712 UTSW 13 67040827 nonsense probably null
R7410:Zfp712 UTSW 13 67041336 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTTTGCCACATTCCTCACA -3'
(R):5'- TGAATGTGGCAAGTCCTTTAATGTTC -3'

Sequencing Primer
(F):5'- GCCACATTCCTCACATATGTAGCG -3'
(R):5'- CCCTACAAATGTGAATGTGGC -3'
Posted On2017-06-26