Incidental Mutation 'R6004:Chrd'
ID478534
Institutional Source Beutler Lab
Gene Symbol Chrd
Ensembl Gene ENSMUSG00000006958
Gene Namechordin
SynonymsChd
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location20733127-20742384 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20735237 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 317 (L317S)
Ref Sequence ENSEMBL: ENSMUSP00000156323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007171] [ENSMUST00000076422] [ENSMUST00000115423] [ENSMUST00000115437] [ENSMUST00000153299] [ENSMUST00000231636] [ENSMUST00000231698] [ENSMUST00000231826] [ENSMUST00000232217] [ENSMUST00000232646]
Predicted Effect probably benign
Transcript: ENSMUST00000007171
AA Change: W274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000007171
Gene: ENSMUSG00000006958
AA Change: W274R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 643 2.03e-31 SMART
low complexity region 676 687 N/A INTRINSIC
VWC 701 758 4.69e-10 SMART
VWC 779 845 5.3e-9 SMART
VWC 867 927 1.68e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000076422
SMART Domains Protein: ENSMUSP00000075756
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 24 188 9.4e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115423
AA Change: W274R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111083
Gene: ENSMUSG00000006958
AA Change: W274R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
CHRD 170 274 1.27e-14 SMART
CHRD 281 395 4.63e-17 SMART
CHRD 400 517 7.81e-24 SMART
CHRD 528 605 3.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115437
SMART Domains Protein: ENSMUSP00000111097
Gene: ENSMUSG00000022847

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EPO_TPO 25 193 5.4e-49 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151150
Predicted Effect probably benign
Transcript: ENSMUST00000153299
SMART Domains Protein: ENSMUSP00000138259
Gene: ENSMUSG00000006958

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VWC 51 125 9.33e-2 SMART
Blast:CHRD 170 236 1e-21 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000231636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231689
Predicted Effect possibly damaging
Transcript: ENSMUST00000231698
AA Change: L317S

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000231826
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232104
Predicted Effect probably benign
Transcript: ENSMUST00000232217
Predicted Effect probably benign
Transcript: ENSMUST00000232646
AA Change: W296R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a secreted protein that dorsalizes early vertebrate embryonic tissues by binding to ventralizing TGF-beta-like bone morphogenetic proteins and sequestering them in latent complexes. The encoded protein may also have roles in organogenesis and during adulthood. It has been suggested that this gene could be a candidate gene for Cornelia de Lange syndrome. Reduced expression of this gene results in enhanced bone regeneration. Alternative splicing results in multiple transcript variants. Other alternative splice variants have been described but their full length sequence has not been determined. [provided by RefSeq, Jan 2015]
PHENOTYPE: Homozygotes for a targeted null mutation show some death prior to embryonic day 8.5, but most die perinatally with abnormalities of the skull, malformations of cervical and thoracic vertebrae, cardiovascular defects, and absence of parathyroid and thymus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Srsf7 A T 17: 80,205,853 D68E probably damaging Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Chrd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Chrd APN 16 20741225 missense possibly damaging 0.89
IGL01486:Chrd APN 16 20734140 splice site probably null
IGL02120:Chrd APN 16 20734541 missense probably damaging 1.00
IGL02370:Chrd APN 16 20735791 missense possibly damaging 0.52
IGL02675:Chrd APN 16 20739949 splice site probably benign
IGL02678:Chrd APN 16 20734020 missense probably damaging 1.00
IGL02874:Chrd APN 16 20735196 missense probably damaging 1.00
ANU74:Chrd UTSW 16 20741319 missense possibly damaging 0.88
PIT1430001:Chrd UTSW 16 20738998 critical splice donor site probably null
R0016:Chrd UTSW 16 20734308 missense possibly damaging 0.85
R0230:Chrd UTSW 16 20733275 missense probably benign 0.25
R0605:Chrd UTSW 16 20735439 missense probably damaging 1.00
R0831:Chrd UTSW 16 20741309 missense probably damaging 0.99
R1501:Chrd UTSW 16 20737533 missense probably damaging 1.00
R1659:Chrd UTSW 16 20735831 missense probably damaging 0.96
R1766:Chrd UTSW 16 20737441 missense probably damaging 1.00
R1823:Chrd UTSW 16 20741347 splice site probably benign
R3001:Chrd UTSW 16 20737445 nonsense probably null
R3002:Chrd UTSW 16 20737445 nonsense probably null
R3874:Chrd UTSW 16 20738910 missense probably damaging 0.99
R4319:Chrd UTSW 16 20737048 missense probably damaging 0.99
R4587:Chrd UTSW 16 20738575 missense possibly damaging 0.58
R4707:Chrd UTSW 16 20738808 missense possibly damaging 0.58
R4857:Chrd UTSW 16 20738758 missense possibly damaging 0.79
R5204:Chrd UTSW 16 20736072 missense probably benign 0.02
R5364:Chrd UTSW 16 20733148 start codon destroyed probably null 0.03
R5445:Chrd UTSW 16 20738910 missense possibly damaging 0.74
R5611:Chrd UTSW 16 20738974 missense probably damaging 1.00
R5940:Chrd UTSW 16 20734586 missense probably null 0.01
R6767:Chrd UTSW 16 20738626 missense probably benign 0.00
R6798:Chrd UTSW 16 20734306 missense probably damaging 1.00
R6801:Chrd UTSW 16 20735747 missense possibly damaging 0.68
R6823:Chrd UTSW 16 20734736 missense probably damaging 1.00
R6999:Chrd UTSW 16 20735652 missense probably benign
R7069:Chrd UTSW 16 20739433 missense probably damaging 1.00
R7136:Chrd UTSW 16 20734522 missense possibly damaging 0.82
R7273:Chrd UTSW 16 20741566 missense probably benign 0.32
R7558:Chrd UTSW 16 20738554 missense probably damaging 1.00
X0063:Chrd UTSW 16 20737564 critical splice donor site probably null
Z1088:Chrd UTSW 16 20741255 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGCTTGTCCTGCATAATTACAG -3'
(R):5'- GCAAGGAATCTTCTGTGTCACTG -3'

Sequencing Primer
(F):5'- GCTTGTCCTGCATAATTACAGTAGGC -3'
(R):5'- GGTGAGCAGGGCTATGC -3'
Posted On2017-06-26