Incidental Mutation 'R6004:Srsf7'
ID478538
Institutional Source Beutler Lab
Gene Symbol Srsf7
Ensembl Gene ENSMUSG00000024097
Gene Nameserine/arginine-rich splicing factor 7
SynonymsSfrs7, 9430065L19Rik, 9G8, NX-96
MMRRC Submission 044182-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6004 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location80200089-80207305 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80205853 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 68 (D68E)
Ref Sequence ENSEMBL: ENSMUSP00000070983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063417] [ENSMUST00000134652]
Predicted Effect probably damaging
Transcript: ENSMUST00000063417
AA Change: D68E

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000070983
Gene: ENSMUSG00000024097
AA Change: D68E

DomainStartEndE-ValueType
RRM 12 80 1.66e-20 SMART
ZnF_C2HC 105 121 1.77e-2 SMART
low complexity region 192 234 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134652
SMART Domains Protein: ENSMUSP00000123158
Gene: ENSMUSG00000046196

DomainStartEndE-ValueType
Pfam:DUF3808 69 522 7.2e-150 PFAM
Meta Mutation Damage Score 0.9136 question?
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.4%
  • 10x: 96.8%
  • 20x: 89.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the serine/arginine (SR)-rich family of pre-mRNA splicing factors, which constitute part of the spliceosome. Each of these factors contains an RNA recognition motif (RRM) for binding RNA and an RS domain for binding other proteins. The RS domain is rich in serine and arginine residues and facilitates interaction between different SR splicing factors. In addition to being critical for mRNA splicing, the SR proteins have also been shown to be involved in mRNA export from the nucleus and in translation. Five transcript variants, four of them protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Sep 2010]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp6 C T 3: 97,175,681 A336V probably benign Het
Adam5 T A 8: 24,781,669 Y574F probably benign Het
Arl6 A T 16: 59,623,894 W80R probably damaging Het
Arntl A T 7: 113,280,727 D22V probably damaging Het
Cars2 A G 8: 11,547,743 I111T probably damaging Het
Chrd T C 16: 20,735,237 L317S possibly damaging Het
Cyp4a12b A G 4: 115,433,467 D262G probably benign Het
Dcaf6 A G 1: 165,388,685 S450P probably benign Het
Dnah3 T C 7: 120,086,297 D164G probably benign Het
Gpx6 A C 13: 21,319,069 T218P probably benign Het
Htr1f T C 16: 64,925,876 N351S probably damaging Het
Idua A G 5: 108,680,644 E241G probably benign Het
Ighv14-2 T A 12: 113,994,635 Q62L probably damaging Het
Ighv1-65 C T 12: 115,532,436 noncoding transcript Het
Inpp4a T C 1: 37,372,370 S372P probably damaging Het
Itgax A T 7: 128,131,452 H114L probably damaging Het
Lama2 A T 10: 27,235,785 F746L probably benign Het
Lrrc37a C T 11: 103,502,536 V688M possibly damaging Het
Ltbp2 A G 12: 84,876,149 V28A probably benign Het
Mill2 A T 7: 18,856,538 D166V probably benign Het
Mroh2a G A 1: 88,248,655 C982Y probably damaging Het
Msh3 T A 13: 92,342,414 probably null Het
Myh15 A T 16: 49,159,699 M1395L probably benign Het
Npepps T C 11: 97,223,124 E642G probably benign Het
Nrg4 T C 9: 55,259,383 T68A possibly damaging Het
Olfr1016 A T 2: 85,799,382 V296E probably damaging Het
Olfr1130 T A 2: 87,607,909 F174I probably damaging Het
Olfr1313 G T 2: 112,072,026 L186I probably damaging Het
Olfr32 T C 2: 90,138,999 N47D probably benign Het
Olfr792 T A 10: 129,540,890 Y118N probably benign Het
Olfr890 A G 9: 38,143,960 K270R probably damaging Het
Otogl T A 10: 107,879,529 I429F probably damaging Het
Pank4 G T 4: 154,977,221 G532C probably damaging Het
Plce1 A G 19: 38,721,871 T1150A probably damaging Het
Ppp2r2b T C 18: 43,059,159 probably null Het
Prkrip1 A G 5: 136,197,782 M68T probably damaging Het
Psme4 T A 11: 30,856,896 probably benign Het
Raet1d T A 10: 22,371,394 I123N probably damaging Het
Rp1 T G 1: 4,197,585 T825P unknown Het
Rttn T C 18: 89,021,692 I839T probably damaging Het
Sgo2b G A 8: 63,926,673 Q1042* probably null Het
Skint11 A G 4: 114,231,728 T240A probably benign Het
Speg A T 1: 75,415,603 K1382* probably null Het
Stag3 A T 5: 138,289,206 D131V probably damaging Het
Strip2 T A 6: 29,926,571 C152S probably damaging Het
Timm44 G T 8: 4,267,747 D191E probably benign Het
Tlnrd1 A G 7: 83,882,779 V148A probably damaging Het
Trp63 T C 16: 25,763,396 probably null Het
Tusc3 G C 8: 39,071,406 G200R probably damaging Het
Vmn2r10 T G 5: 108,999,078 N448T probably benign Het
Vmn2r50 G A 7: 10,050,059 R163C probably benign Het
Vmn2r53 T C 7: 12,582,401 H497R probably benign Het
Vps39 A G 2: 120,345,650 V83A possibly damaging Het
Ylpm1 A T 12: 85,029,084 N861I possibly damaging Het
Zfp712 A G 13: 67,041,705 C253R probably damaging Het
Zfp930 A G 8: 69,227,904 T84A probably benign Het
Other mutations in Srsf7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02059:Srsf7 APN 17 80202692 missense probably null
IGL02544:Srsf7 APN 17 80204191 unclassified probably benign
R1036:Srsf7 UTSW 17 80205837 unclassified probably benign
R3014:Srsf7 UTSW 17 80201561 missense unknown
R6298:Srsf7 UTSW 17 80207253 unclassified probably benign
R6551:Srsf7 UTSW 17 80204219 unclassified probably benign
R7683:Srsf7 UTSW 17 80207274 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GACAGAATGAGGGCTCCAAC -3'
(R):5'- GAAATGAATTCCCTATCACACGTTG -3'

Sequencing Primer
(F):5'- CCACCACCGGAGCTATATGGTG -3'
(R):5'- CCCTATCACACGTTGAATAACATTTG -3'
Posted On2017-06-26