Incidental Mutation 'R6015:2310035C23Rik'
ID478541
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R6015 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105691958 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 280 (L280S)
Ref Sequence ENSEMBL: ENSMUSP00000141162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably damaging
Transcript: ENSMUST00000039173
AA Change: L304S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319
AA Change: L304S

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000086721
AA Change: L304S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319
AA Change: L304S

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably damaging
Transcript: ENSMUST00000186807
AA Change: L304S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319
AA Change: L304S

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189091
Predicted Effect probably damaging
Transcript: ENSMUST00000190501
AA Change: L280S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319
AA Change: L280S

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191293
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0022:2310035C23Rik UTSW 1 105691902 splice site probably benign
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
R7209:2310035C23Rik UTSW 1 105750357 missense probably damaging 1.00
R7284:2310035C23Rik UTSW 1 105734583 missense probably benign 0.01
R7292:2310035C23Rik UTSW 1 105721416 critical splice donor site probably null
R7534:2310035C23Rik UTSW 1 105741023 missense probably benign 0.01
R7740:2310035C23Rik UTSW 1 105731261 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATCTAATTTGGCAGCAAGTG -3'
(R):5'- CTGATTTGCTCCATCAATGACC -3'

Sequencing Primer
(F):5'- AAGTGTCTTTGCCCACCGAG -3'
(R):5'- CTAATTTCTGTACTAGCAAGGTGTTC -3'
Posted On2017-06-26