Incidental Mutation 'R6015:Pfkfb3'
ID478544
Institutional Source Beutler Lab
Gene Symbol Pfkfb3
Ensembl Gene ENSMUSG00000026773
Gene Name6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
SynonymsE330010H22Rik, uPFK-2
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6015 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location11471433-11554077 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 11481335 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028114] [ENSMUST00000049849] [ENSMUST00000100411] [ENSMUST00000114844] [ENSMUST00000114844] [ENSMUST00000114844] [ENSMUST00000114844] [ENSMUST00000114845] [ENSMUST00000114846] [ENSMUST00000170196] [ENSMUST00000170196] [ENSMUST00000171188] [ENSMUST00000171188] [ENSMUST00000171188] [ENSMUST00000171188] [ENSMUST00000179584] [ENSMUST00000179584] [ENSMUST00000183869] [ENSMUST00000191668] [ENSMUST00000191668] [ENSMUST00000192949] [ENSMUST00000195779]
Predicted Effect probably benign
Transcript: ENSMUST00000028114
SMART Domains Protein: ENSMUSP00000028114
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000049849
SMART Domains Protein: ENSMUSP00000050926
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.3e-110 PFAM
Pfam:KTI12 36 218 9.7e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100411
SMART Domains Protein: ENSMUSP00000097979
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 5.8e-110 PFAM
Pfam:KTI12 36 219 9.6e-9 PFAM
Pfam:AAA_33 37 191 2.4e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114844
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114844
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114844
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114844
SMART Domains Protein: ENSMUSP00000110493
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 6.6e-110 PFAM
Pfam:KTI12 36 218 1.1e-8 PFAM
Pfam:AAA_33 37 191 2.6e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114845
SMART Domains Protein: ENSMUSP00000110494
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.6e-110 PFAM
Pfam:KTI12 36 218 7e-9 PFAM
Pfam:AAA_33 37 191 1.7e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000114846
SMART Domains Protein: ENSMUSP00000110495
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.1e-110 PFAM
Pfam:KTI12 36 219 9e-9 PFAM
Pfam:AAA_33 37 191 1.9e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150086
Predicted Effect probably null
Transcript: ENSMUST00000170196
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170196
SMART Domains Protein: ENSMUSP00000126305
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.4e-110 PFAM
Pfam:KTI12 36 218 9.9e-9 PFAM
Pfam:AAA_33 37 191 2e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171188
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171188
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171188
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000171188
SMART Domains Protein: ENSMUSP00000129122
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.2e-110 PFAM
Pfam:KTI12 36 209 4.2e-8 PFAM
Pfam:AAA_33 37 167 1.8e-9 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179584
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000179584
SMART Domains Protein: ENSMUSP00000137130
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183869
SMART Domains Protein: ENSMUSP00000138893
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 2.3e-110 PFAM
Pfam:KTI12 36 225 7e-9 PFAM
Pfam:AAA_33 37 191 1.5e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191668
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect probably null
Transcript: ENSMUST00000191668
SMART Domains Protein: ENSMUSP00000142079
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 24 246 3.6e-110 PFAM
Pfam:KTI12 36 218 1e-8 PFAM
Pfam:AAA_33 37 191 2.1e-10 PFAM
PGAM 248 395 5.09e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192844
Predicted Effect probably benign
Transcript: ENSMUST00000192949
SMART Domains Protein: ENSMUSP00000142296
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 3 226 1.9e-107 PFAM
Pfam:KTI12 16 200 3.9e-6 PFAM
Pfam:AAA_33 17 171 1.9e-8 PFAM
PGAM 228 375 3.8e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000195779
SMART Domains Protein: ENSMUSP00000141445
Gene: ENSMUSG00000026773

DomainStartEndE-ValueType
Pfam:6PF2K 3 159 1.3e-69 PFAM
Pfam:KTI12 16 212 1.8e-6 PFAM
Pfam:AAA_33 17 163 1.6e-9 PFAM
Pfam:6PF2K 158 242 2.2e-32 PFAM
Pfam:His_Phos_1 244 326 3.4e-13 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of bifunctional proteins that are involved in both the synthesis and degradation of fructose-2,6-bisphosphate, a regulatory molecule that controls glycolysis in eukaryotes. The encoded protein has a 6-phosphofructo-2-kinase activity that catalyzes the synthesis of fructose-2,6-bisphosphate (F2,6BP), and a fructose-2,6-biphosphatase activity that catalyzes the degradation of F2,6BP. This protein is required for cell cycle progression and prevention of apoptosis. It functions as a regulator of cyclin-dependent kinase 1, linking glucose metabolism to cell proliferation and survival in tumor cells. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null mice display embryonic lethality before E8 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Pfkfb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Pfkfb3 APN 2 11488754 missense probably damaging 1.00
IGL01651:Pfkfb3 APN 2 11489684 missense probably damaging 0.97
IGL02010:Pfkfb3 APN 2 11483994 missense probably benign
IGL02546:Pfkfb3 APN 2 11488778 missense probably damaging 1.00
IGL03182:Pfkfb3 APN 2 11501663 missense probably damaging 0.99
R1491:Pfkfb3 UTSW 2 11493936 missense probably damaging 1.00
R2365:Pfkfb3 UTSW 2 11493902 critical splice donor site probably null
R2919:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R2920:Pfkfb3 UTSW 2 11484327 missense probably benign 0.00
R4709:Pfkfb3 UTSW 2 11493908 missense probably damaging 1.00
R4863:Pfkfb3 UTSW 2 11486312 missense probably benign
R4915:Pfkfb3 UTSW 2 11490298 nonsense probably null
R5087:Pfkfb3 UTSW 2 11484014 missense probably damaging 1.00
R5109:Pfkfb3 UTSW 2 11486351 splice site probably benign
R5244:Pfkfb3 UTSW 2 11484849 missense probably damaging 1.00
R5488:Pfkfb3 UTSW 2 11484669 missense probably benign 0.00
R5573:Pfkfb3 UTSW 2 11501672 missense probably benign 0.28
R5619:Pfkfb3 UTSW 2 11484659 missense probably benign 0.00
R5757:Pfkfb3 UTSW 2 11480330 missense probably damaging 0.99
R7495:Pfkfb3 UTSW 2 11482501 missense probably damaging 1.00
R7688:Pfkfb3 UTSW 2 11492639 missense probably damaging 1.00
R7813:Pfkfb3 UTSW 2 11481908 missense probably benign 0.12
X0024:Pfkfb3 UTSW 2 11482555 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGGTCCACAGTGCAAGTGAG -3'
(R):5'- TGGATCAGCCAGTCAGCAAC -3'

Sequencing Primer
(F):5'- GGCAGAAAACAGGCTGACACC -3'
(R):5'- ATGGGCATCCTACAGTATGGC -3'
Posted On2017-06-26