Mutagenetix > Incidental Mutation

Incidental Mutation 'R6015:Aqr'

478546

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

043254-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6015 (G1)

Quality Score

92.0077

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

start codon destroyed

DNA Base Change (assembly)

A to G at 114175165 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 1 (M1T)

Ref Sequence

ENSEMBL: ENSMUSP00000047157 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

AlphaFold

Q8CFQ3

Predicted Effect

probably null
Transcript: ENSMUST00000043160
AA Change: M1T

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: M1T

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102543
AA Change: M1T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: M1T

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147191

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154317

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,691,958	L280S	probably damaging	Het
Ano5	A	C	7: 51,574,777	S480R	probably benign	Het
Arhgef28	A	G	13: 98,075,022	V151A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,102,496	I170N	probably damaging	Het
Atxn2	T	A	5: 121,810,992	V817D	probably damaging	Het
Cdh23	A	C	10: 60,307,982	I2950S	probably damaging	Het
Ces1h	A	G	8: 93,357,063	L417P	unknown	Het
Csf1r	A	G	18: 61,109,712	E49G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fat3	A	G	9: 16,376,050	S726P	possibly damaging	Het
Grik2	A	T	10: 49,523,863		probably null	Het
Il9r	A	G	11: 32,192,674	V287A	probably benign	Het
Inpp5b	T	C	4: 124,798,350	C909R	possibly damaging	Het
Kat7	G	A	11: 95,284,034	H384Y	probably damaging	Het
Lama5	A	G	2: 180,185,392	S2272P	probably benign	Het
Megf10	A	G	18: 57,253,028	H371R	probably benign	Het
Moxd2	A	T	6: 40,883,754	Y310N	probably damaging	Het
Ntrk2	A	T	13: 59,060,395	E685V	probably damaging	Het
Ogfr	G	T	2: 180,594,674	G351W	probably damaging	Het
Olfr655	G	T	7: 104,596,708	P158T	probably damaging	Het
Parp3	C	T	9: 106,474,282	V207M	possibly damaging	Het
Pfkfb3	T	C	2: 11,481,335		probably null	Het
Pifo	T	C	3: 105,999,621	D154G	possibly damaging	Het
Pigr	T	C	1: 130,847,261	V475A	probably benign	Het
Pik3ap1	T	A	19: 41,328,201	Y250F	probably benign	Het
Ppp1r3c	A	T	19: 36,733,806	I188N	probably damaging	Het
Prmt7	T	G	8: 106,235,008		probably benign	Het
Psapl1	T	C	5: 36,204,250	V62A	probably benign	Het
Rpp14	G	A	14: 8,090,462	V129I	probably benign	Het
Sema4f	A	G	6: 82,939,572		probably benign	Het
Serpinb13	C	A	1: 107,000,607	A319E	probably benign	Het
Sez6l2	A	T	7: 126,953,453	S134C	probably damaging	Het
Slc4a10	T	A	2: 62,228,702	H184Q	probably benign	Het
Slc9a9	G	T	9: 94,939,549	A330S	probably benign	Het
Sord	T	C	2: 122,256,943	V176A	probably damaging	Het
Ssbp2	G	T	13: 91,669,743		probably null	Het
Stab2	G	T	10: 86,938,042	N808K	probably damaging	Het
Syne1	A	G	10: 5,346,819		probably null	Het
Tpcn2	A	G	7: 145,266,851	V341A	probably damaging	Het
Unc13b	C	A	4: 43,177,995	S2941*	probably null	Het
Utrn	T	A	10: 12,478,424	H2806L	possibly damaging	Het
Vmn1r40	C	A	6: 89,714,606	A135D	probably damaging	Het
Vmn1r68	C	T	7: 10,527,689	V161M	probably benign	Het
Wiz	T	A	17: 32,387,600	I54F	probably damaging	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4663:Aqr	UTSW	2	114161666	nonsense	probably null
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
R9487:Aqr	UTSW	2	114104047	missense	probably benign	0.04
R9527:Aqr	UTSW	2	114101556	missense	probably benign	0.02
R9664:Aqr	UTSW	2	114140915	nonsense	probably null
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GCTTTGTGGTCTAACGAGGAGC -3'
(R):5'- TAGTTCTGCTTCCGGGGAAC -3'

Sequencing Primer
(F):5'- AGGAGCGGCCTCTTTCACTG -3'
(R):5'- AACGCCGGGACTTCTCAG -3'

Posted On

2017-06-26