Incidental Mutation 'R6015:Psapl1'
ID478553
Institutional Source Beutler Lab
Gene Symbol Psapl1
Ensembl Gene ENSMUSG00000043430
Gene Nameprosaposin-like 1
Synonyms2310020A21Rik
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R6015 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location36204021-36206568 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36204250 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 62 (V62A)
Ref Sequence ENSEMBL: ENSMUSP00000100594 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037370] [ENSMUST00000052224] [ENSMUST00000070720] [ENSMUST00000135324]
Predicted Effect probably benign
Transcript: ENSMUST00000037370
SMART Domains Protein: ENSMUSP00000041828
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
VPS10 170 780 N/A SMART
PKD 782 872 7.27e-2 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000052224
AA Change: V62A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000100594
Gene: ENSMUSG00000043430
AA Change: V62A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
SAPA 25 58 1.19e-12 SMART
SapB 65 143 9.63e-7 SMART
SapB 188 260 8.51e-8 SMART
SapB 296 370 9.82e-22 SMART
SapB 398 473 8.37e-16 SMART
SAPA 482 515 2.01e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000070720
SMART Domains Protein: ENSMUSP00000065292
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
signal peptide 1 51 N/A INTRINSIC
low complexity region 54 64 N/A INTRINSIC
low complexity region 89 103 N/A INTRINSIC
low complexity region 106 130 N/A INTRINSIC
Blast:VPS10 170 213 2e-22 BLAST
low complexity region 214 227 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135324
SMART Domains Protein: ENSMUSP00000123543
Gene: ENSMUSG00000029093

DomainStartEndE-ValueType
SCOP:d1eur__ 1 111 2e-3 SMART
Blast:VPS10 1 173 1e-126 BLAST
PDB:4N7E|A 6 117 1e-8 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137040
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141508
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to the glycoprotein prosaposin. Based on sequence similarity between the encoded protein and prosaposin, it is predicted that the encoded protein is a preproprotein that is proteolytically processed to generate multiple protein products. These predicted products include saposins A-like, B-like, C-like, and D-like, which may play a role in the lysosomal degradation of sphingolipids. [provided by RefSeq, Jul 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Psapl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Psapl1 APN 5 36205631 missense probably benign
IGL01873:Psapl1 APN 5 36205225 missense possibly damaging 0.66
IGL02590:Psapl1 APN 5 36205053 missense probably benign
IGL02931:Psapl1 APN 5 36204889 missense probably damaging 1.00
R0138:Psapl1 UTSW 5 36204631 missense probably damaging 0.98
R0570:Psapl1 UTSW 5 36204280 missense possibly damaging 0.89
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R1313:Psapl1 UTSW 5 36205266 missense probably benign 0.01
R2207:Psapl1 UTSW 5 36205165 missense probably damaging 1.00
R2247:Psapl1 UTSW 5 36205066 missense probably benign 0.01
R4792:Psapl1 UTSW 5 36205203 missense probably benign
R4865:Psapl1 UTSW 5 36204867 missense probably damaging 1.00
R5101:Psapl1 UTSW 5 36204150 missense probably damaging 1.00
R5947:Psapl1 UTSW 5 36204307 missense probably benign 0.08
R6751:Psapl1 UTSW 5 36204959 nonsense probably null
R7260:Psapl1 UTSW 5 36205212 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TATGCTGTGCGCTCTGATTC -3'
(R):5'- ACACAGAAGCCAGGTCAGTCTC -3'

Sequencing Primer
(F):5'- CGCTCTGATTCTCTGGTCTGG -3'
(R):5'- TGAGCATGCTCAGGACAGCTG -3'
Posted On2017-06-26