Incidental Mutation 'R6015:Moxd2'
ID478555
Institutional Source Beutler Lab
Gene Symbol Moxd2
Ensembl Gene ENSMUSG00000029885
Gene Namemonooxygenase, DBH-like 2
SynonymsDbhl1
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6015 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location40878794-40887494 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 40883754 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 310 (Y310N)
Ref Sequence ENSEMBL: ENSMUSP00000031937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031937]
Predicted Effect probably damaging
Transcript: ENSMUST00000031937
AA Change: Y310N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000031937
Gene: ENSMUSG00000029885
AA Change: Y310N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
DoH 66 156 1.43e-12 SMART
Pfam:Cu2_monooxygen 192 316 8.3e-39 PFAM
Pfam:Cu2_monoox_C 336 493 1.8e-37 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Parp3 C T 9: 106,474,282 V207M possibly damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Moxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Moxd2 APN 6 40884179 splice site probably benign
IGL02113:Moxd2 APN 6 40885404 missense probably benign 0.06
IGL02223:Moxd2 APN 6 40885033 missense probably damaging 1.00
IGL03204:Moxd2 APN 6 40887305 missense probably benign 0.04
IGL03385:Moxd2 APN 6 40879018 missense probably damaging 1.00
R0084:Moxd2 UTSW 6 40879408 missense probably null 0.01
R1213:Moxd2 UTSW 6 40891897 unclassified probably benign
R1326:Moxd2 UTSW 6 40880354 missense probably benign 0.00
R1652:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
R1940:Moxd2 UTSW 6 40883532 missense probably damaging 1.00
R2040:Moxd2 UTSW 6 40884953 splice site probably null
R2088:Moxd2 UTSW 6 40884967 missense probably damaging 1.00
R3018:Moxd2 UTSW 6 40878886 missense probably benign 0.01
R3962:Moxd2 UTSW 6 40885397 missense probably benign
R4248:Moxd2 UTSW 6 40878999 missense probably damaging 1.00
R4438:Moxd2 UTSW 6 40884062 missense probably damaging 1.00
R4715:Moxd2 UTSW 6 40887247 missense probably damaging 1.00
R4732:Moxd2 UTSW 6 40878859 missense probably benign
R4733:Moxd2 UTSW 6 40878859 missense probably benign
R4760:Moxd2 UTSW 6 40891603 missense probably benign 0.06
R4851:Moxd2 UTSW 6 40878822 missense probably damaging 1.00
R5087:Moxd2 UTSW 6 40879336 missense probably damaging 1.00
R5187:Moxd2 UTSW 6 40879337 missense probably benign 0.18
R5339:Moxd2 UTSW 6 40885420 missense probably damaging 1.00
R5452:Moxd2 UTSW 6 40882114 splice site probably null
R5860:Moxd2 UTSW 6 40880407 missense probably damaging 1.00
R5973:Moxd2 UTSW 6 40878810 missense probably damaging 0.96
R6316:Moxd2 UTSW 6 40883547 missense probably damaging 1.00
R7561:Moxd2 UTSW 6 40887403 missense probably damaging 1.00
X0052:Moxd2 UTSW 6 40882528 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAATATTCTCCTCAGACGGTGG -3'
(R):5'- GTACATGCTGTTAGGCCATGG -3'

Sequencing Primer
(F):5'- GGAGTGGGTCACAATGTTCAG -3'
(R):5'- AACTGGGGGCATAGAAGTTC -3'
Posted On2017-06-26