Incidental Mutation 'R6015:Parp3'
ID478569
Institutional Source Beutler Lab
Gene Symbol Parp3
Ensembl Gene ENSMUSG00000023249
Gene Namepoly (ADP-ribose) polymerase family, member 3
SynonymsA930002C11Rik, PARP-3, Adprt3, Adprtl3
MMRRC Submission 043254-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6015 (G1)
Quality Score165.009
Status Not validated
Chromosome9
Chromosomal Location106470322-106476949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 106474282 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 207 (V207M)
Ref Sequence ENSEMBL: ENSMUSP00000123054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047721] [ENSMUST00000067218] [ENSMUST00000112479] [ENSMUST00000123555] [ENSMUST00000125850] [ENSMUST00000156426] [ENSMUST00000214682]
Predicted Effect probably benign
Transcript: ENSMUST00000047721
SMART Domains Protein: ENSMUSP00000038580
Gene: ENSMUSG00000041506

DomainStartEndE-ValueType
low complexity region 8 30 N/A INTRINSIC
low complexity region 47 57 N/A INTRINSIC
coiled coil region 61 102 N/A INTRINSIC
WD40 135 174 1.15e-4 SMART
WD40 177 227 3.09e-5 SMART
WD40 230 269 2.42e-7 SMART
WD40 272 311 9.24e-4 SMART
WD40 313 351 2.4e-2 SMART
WD40 354 404 4.6e0 SMART
Blast:WD40 412 451 1e-15 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000067218
AA Change: V207M

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000064513
Gene: ENSMUSG00000023249
AA Change: V207M

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112479
AA Change: V212M

PolyPhen 2 Score 0.575 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108098
Gene: ENSMUSG00000023249
AA Change: V212M

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 182 319 1.3e-42 PFAM
Pfam:PARP 322 533 7.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123464
Predicted Effect possibly damaging
Transcript: ENSMUST00000123555
AA Change: V207M

PolyPhen 2 Score 0.717 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000123054
Gene: ENSMUSG00000023249
AA Change: V207M

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Pfam:PARP_reg 176 315 8.7e-39 PFAM
Pfam:PARP 317 528 7.1e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125630
Predicted Effect probably benign
Transcript: ENSMUST00000125850
SMART Domains Protein: ENSMUSP00000119244
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145396
Predicted Effect probably benign
Transcript: ENSMUST00000156426
SMART Domains Protein: ENSMUSP00000117329
Gene: ENSMUSG00000023249

DomainStartEndE-ValueType
WGR 64 141 1.83e-37 SMART
PDB:4L7U|A 179 202 6e-7 PDB
SCOP:d1a26_1 182 202 5e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000214682
AA Change: V207M

PolyPhen 2 Score 0.496 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217303
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the PARP family. These enzymes modify nuclear proteins by poly-ADP-ribosylation, which is required for DNA repair, regulation of apoptosis, and maintenance of genomic stability. This gene encodes the poly(ADP-ribosyl)transferase 3, which is preferentially localized to the daughter centriole throughout the cell cycle. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal survival. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T C 1: 105,691,958 L280S probably damaging Het
Ano5 A C 7: 51,574,777 S480R probably benign Het
Aqr A G 2: 114,175,165 M1T probably null Het
Arhgef28 A G 13: 98,075,022 V151A possibly damaging Het
Atp6v1b2 T A 8: 69,102,496 I170N probably damaging Het
Atxn2 T A 5: 121,810,992 V817D probably damaging Het
Cdh23 A C 10: 60,307,982 I2950S probably damaging Het
Ces1h A G 8: 93,357,063 L417P unknown Het
Csf1r A G 18: 61,109,712 E49G possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fat3 A G 9: 16,376,050 S726P possibly damaging Het
Grik2 A T 10: 49,523,863 probably null Het
Il9r A G 11: 32,192,674 V287A probably benign Het
Inpp5b T C 4: 124,798,350 C909R possibly damaging Het
Kat7 G A 11: 95,284,034 H384Y probably damaging Het
Lama5 A G 2: 180,185,392 S2272P probably benign Het
Megf10 A G 18: 57,253,028 H371R probably benign Het
Moxd2 A T 6: 40,883,754 Y310N probably damaging Het
Ntrk2 A T 13: 59,060,395 E685V probably damaging Het
Ogfr G T 2: 180,594,674 G351W probably damaging Het
Olfr655 G T 7: 104,596,708 P158T probably damaging Het
Pfkfb3 T C 2: 11,481,335 probably null Het
Pifo T C 3: 105,999,621 D154G possibly damaging Het
Pigr T C 1: 130,847,261 V475A probably benign Het
Pik3ap1 T A 19: 41,328,201 Y250F probably benign Het
Ppp1r3c A T 19: 36,733,806 I188N probably damaging Het
Prmt7 T G 8: 106,235,008 probably benign Het
Psapl1 T C 5: 36,204,250 V62A probably benign Het
Rpp14 G A 14: 8,090,462 V129I probably benign Het
Sema4f A G 6: 82,939,572 probably benign Het
Serpinb13 C A 1: 107,000,607 A319E probably benign Het
Sez6l2 A T 7: 126,953,453 S134C probably damaging Het
Slc4a10 T A 2: 62,228,702 H184Q probably benign Het
Slc9a9 G T 9: 94,939,549 A330S probably benign Het
Sord T C 2: 122,256,943 V176A probably damaging Het
Ssbp2 G T 13: 91,669,743 probably null Het
Stab2 G T 10: 86,938,042 N808K probably damaging Het
Syne1 A G 10: 5,346,819 probably null Het
Tpcn2 A G 7: 145,266,851 V341A probably damaging Het
Unc13b C A 4: 43,177,995 S2941* probably null Het
Utrn T A 10: 12,478,424 H2806L possibly damaging Het
Vmn1r40 C A 6: 89,714,606 A135D probably damaging Het
Vmn1r68 C T 7: 10,527,689 V161M probably benign Het
Wiz T A 17: 32,387,600 I54F probably damaging Het
Other mutations in Parp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Parp3 APN 9 106471387 missense probably benign
IGL00827:Parp3 APN 9 106474406 missense probably benign 0.17
IGL02683:Parp3 APN 9 106473185 missense possibly damaging 0.84
R0050:Parp3 UTSW 9 106471401 missense possibly damaging 0.81
R0110:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0320:Parp3 UTSW 9 106475812 missense possibly damaging 0.76
R0510:Parp3 UTSW 9 106471796 missense possibly damaging 0.81
R0989:Parp3 UTSW 9 106473082 splice site probably null
R1170:Parp3 UTSW 9 106476005 intron probably benign
R1919:Parp3 UTSW 9 106475117 missense possibly damaging 0.92
R1935:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1936:Parp3 UTSW 9 106474732 missense probably damaging 1.00
R1958:Parp3 UTSW 9 106474822 unclassified probably null
R2188:Parp3 UTSW 9 106475852 missense probably damaging 0.99
R2919:Parp3 UTSW 9 106473725 missense possibly damaging 0.84
R3014:Parp3 UTSW 9 106471315 missense possibly damaging 0.66
R3429:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3430:Parp3 UTSW 9 106474723 missense probably damaging 0.99
R3618:Parp3 UTSW 9 106475063 missense possibly damaging 0.81
R3980:Parp3 UTSW 9 106474068 missense probably damaging 1.00
R4840:Parp3 UTSW 9 106473109 missense probably damaging 1.00
R5617:Parp3 UTSW 9 106474505 missense possibly damaging 0.75
R6591:Parp3 UTSW 9 106473692 missense probably benign
R6691:Parp3 UTSW 9 106473692 missense probably benign
R7403:Parp3 UTSW 9 106474853 missense probably benign 0.35
R7612:Parp3 UTSW 9 106474194 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCTTGGCCTGAAGCACATC -3'
(R):5'- TTATCTCCCCAGGTGTACAGC -3'

Sequencing Primer
(F):5'- CTGAAGCACATCAGGGGAGTTG -3'
(R):5'- CTGTGAGGACCGTGGTCAAG -3'
Posted On2017-06-26