Mutagenetix > Incidental Mutations

Incidental Mutation 'R6015:Cdh23'

478572

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

MMRRC Submission

043254-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.673) question?

Stock #

R6015 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 60307982 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 2950 (I2950S)

Ref Sequence

ENSEMBL: ENSMUSP00000101102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000073242
AA Change: I2947S

PolyPhen 2 Score 0.545 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: I2947S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105461
AA Change: I2948S

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: I2948S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105462
AA Change: I2950S

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: I2950S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105463
AA Change: I2948S

PolyPhen 2 Score 0.680 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: I2948S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: I2946S

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: I2946S

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151194

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153525

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156501

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,691,958	L280S	probably damaging	Het
Ano5	A	C	7: 51,574,777	S480R	probably benign	Het
Aqr	A	G	2: 114,175,165	M1T	probably null	Het
Arhgef28	A	G	13: 98,075,022	V151A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,102,496	I170N	probably damaging	Het
Atxn2	T	A	5: 121,810,992	V817D	probably damaging	Het
Ces1h	A	G	8: 93,357,063	L417P	unknown	Het
Csf1r	A	G	18: 61,109,712	E49G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fat3	A	G	9: 16,376,050	S726P	possibly damaging	Het
Grik2	A	T	10: 49,523,863		probably null	Het
Il9r	A	G	11: 32,192,674	V287A	probably benign	Het
Inpp5b	T	C	4: 124,798,350	C909R	possibly damaging	Het
Kat7	G	A	11: 95,284,034	H384Y	probably damaging	Het
Lama5	A	G	2: 180,185,392	S2272P	probably benign	Het
Megf10	A	G	18: 57,253,028	H371R	probably benign	Het
Moxd2	A	T	6: 40,883,754	Y310N	probably damaging	Het
Ntrk2	A	T	13: 59,060,395	E685V	probably damaging	Het
Ogfr	G	T	2: 180,594,674	G351W	probably damaging	Het
Olfr655	G	T	7: 104,596,708	P158T	probably damaging	Het
Parp3	C	T	9: 106,474,282	V207M	possibly damaging	Het
Pfkfb3	T	C	2: 11,481,335		probably null	Het
Pifo	T	C	3: 105,999,621	D154G	possibly damaging	Het
Pigr	T	C	1: 130,847,261	V475A	probably benign	Het
Pik3ap1	T	A	19: 41,328,201	Y250F	probably benign	Het
Ppp1r3c	A	T	19: 36,733,806	I188N	probably damaging	Het
Prmt7	T	G	8: 106,235,008		probably benign	Het
Psapl1	T	C	5: 36,204,250	V62A	probably benign	Het
Rpp14	G	A	14: 8,090,462	V129I	probably benign	Het
Sema4f	A	G	6: 82,939,572		probably benign	Het
Serpinb13	C	A	1: 107,000,607	A319E	probably benign	Het
Sez6l2	A	T	7: 126,953,453	S134C	probably damaging	Het
Slc4a10	T	A	2: 62,228,702	H184Q	probably benign	Het
Slc9a9	G	T	9: 94,939,549	A330S	probably benign	Het
Sord	T	C	2: 122,256,943	V176A	probably damaging	Het
Ssbp2	G	T	13: 91,669,743		probably null	Het
Stab2	G	T	10: 86,938,042	N808K	probably damaging	Het
Syne1	A	G	10: 5,346,819		probably null	Het
Tpcn2	A	G	7: 145,266,851	V341A	probably damaging	Het
Unc13b	C	A	4: 43,177,995	S2941*	probably null	Het
Utrn	T	A	10: 12,478,424	H2806L	possibly damaging	Het
Vmn1r40	C	A	6: 89,714,606	A135D	probably damaging	Het
Vmn1r68	C	T	7: 10,527,689	V161M	probably benign	Het
Wiz	T	A	17: 32,387,600	I54F	probably damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60379343	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2111:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60315692	nonsense	probably null
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60305152	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60312577	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60385194	missense	probably benign	0.07
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CATCCCTCAAAGCCATGTGG -3'
(R):5'- ATCAGTATGTGTGGCCTCTG -3'

Sequencing Primer
(F):5'- CCATGTGGCTATGAAGTGATTAAG -3'
(R):5'- TCTGAGCTGTGCCACCC -3'

Posted On

2017-06-26