Mutagenetix > Incidental Mutation

Incidental Mutation 'R6015:Megf10'

478581

Institutional Source

Beutler Lab

Gene Symbol

Megf10

Ensembl Gene

ENSMUSG00000024593

Gene Name

multiple EGF-like-domains 10

Synonyms

3000002B06Rik, LOC240312

MMRRC Submission

043254-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.139) question?

Stock #

R6015 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57133090-57297467 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 57253028 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 371 (H371R)

Ref Sequence

ENSEMBL: ENSMUSP00000075174 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075770] [ENSMUST00000139892]

AlphaFold

Q6DIB5

Predicted Effect

probably benign
Transcript: ENSMUST00000075770
AA Change: H371R

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000075174
Gene: ENSMUSG00000024593
AA Change: H371R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC
low complexity region	1131	1146	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000139892
AA Change: H371R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116814
Gene: ENSMUSG00000024593
AA Change: H371R

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
EGF	108	136	9.41e-2	SMART
EGF_Lam	152	191	3.57e-2	SMART
EGF	190	222	5.79e-2	SMART
EGF	233	265	1.78e-2	SMART
EGF_Lam	281	320	7.58e-6	SMART
EGF	319	351	7.13e-2	SMART
EGF_Lam	368	409	9.05e-4	SMART
EGF	408	440	8.78e-2	SMART
EGF	451	483	2.85e-1	SMART
EGF	494	526	2.02e-1	SMART
EGF_Lam	542	581	1.04e-3	SMART
EGF	580	612	1.91e-2	SMART
EGF	623	657	2.16e1	SMART
EGF	668	700	2.48e-1	SMART
EGF	711	743	2.81e0	SMART
EGF_Lam	759	798	4.16e-3	SMART
EGF	797	829	1.73e0	SMART
transmembrane domain	856	878	N/A	INTRINSIC
low complexity region	1014	1026	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the multiple epidermal growth factor-like domains protein family. The encoded protein plays a role in cell adhesion, motility and proliferation, and is a critical mediator of apoptotic cell phagocytosis as well as amyloid-beta peptide uptake in the brain. Expression of this gene may be associated with schizophrenia, and mutations in this gene are a cause of early-onset myopathy, areflexia, respiratory distress, and dysphagia (EMARDD) as well as congenital myopathy with minicores. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a targeted allele exhibit abnormal spacing of starburst amacrine cells and horizontal cells. Homozygotes for another targeted allele exhibit impaired phagocytosis of apoptotic cells by astrocytes. Mice heterozygous for this same allele exhibit mild disorganization of starburts amacrine cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	C	1: 105,691,958	L280S	probably damaging	Het
Ano5	A	C	7: 51,574,777	S480R	probably benign	Het
Aqr	A	G	2: 114,175,165	M1T	probably null	Het
Arhgef28	A	G	13: 98,075,022	V151A	possibly damaging	Het
Atp6v1b2	T	A	8: 69,102,496	I170N	probably damaging	Het
Atxn2	T	A	5: 121,810,992	V817D	probably damaging	Het
Cdh23	A	C	10: 60,307,982	I2950S	probably damaging	Het
Ces1h	A	G	8: 93,357,063	L417P	unknown	Het
Csf1r	A	G	18: 61,109,712	E49G	possibly damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fat3	A	G	9: 16,376,050	S726P	possibly damaging	Het
Grik2	A	T	10: 49,523,863		probably null	Het
Il9r	A	G	11: 32,192,674	V287A	probably benign	Het
Inpp5b	T	C	4: 124,798,350	C909R	possibly damaging	Het
Kat7	G	A	11: 95,284,034	H384Y	probably damaging	Het
Lama5	A	G	2: 180,185,392	S2272P	probably benign	Het
Moxd2	A	T	6: 40,883,754	Y310N	probably damaging	Het
Ntrk2	A	T	13: 59,060,395	E685V	probably damaging	Het
Ogfr	G	T	2: 180,594,674	G351W	probably damaging	Het
Olfr655	G	T	7: 104,596,708	P158T	probably damaging	Het
Parp3	C	T	9: 106,474,282	V207M	possibly damaging	Het
Pfkfb3	T	C	2: 11,481,335		probably null	Het
Pifo	T	C	3: 105,999,621	D154G	possibly damaging	Het
Pigr	T	C	1: 130,847,261	V475A	probably benign	Het
Pik3ap1	T	A	19: 41,328,201	Y250F	probably benign	Het
Ppp1r3c	A	T	19: 36,733,806	I188N	probably damaging	Het
Prmt7	T	G	8: 106,235,008		probably benign	Het
Psapl1	T	C	5: 36,204,250	V62A	probably benign	Het
Rpp14	G	A	14: 8,090,462	V129I	probably benign	Het
Sema4f	A	G	6: 82,939,572		probably benign	Het
Serpinb13	C	A	1: 107,000,607	A319E	probably benign	Het
Sez6l2	A	T	7: 126,953,453	S134C	probably damaging	Het
Slc4a10	T	A	2: 62,228,702	H184Q	probably benign	Het
Slc9a9	G	T	9: 94,939,549	A330S	probably benign	Het
Sord	T	C	2: 122,256,943	V176A	probably damaging	Het
Ssbp2	G	T	13: 91,669,743		probably null	Het
Stab2	G	T	10: 86,938,042	N808K	probably damaging	Het
Syne1	A	G	10: 5,346,819		probably null	Het
Tpcn2	A	G	7: 145,266,851	V341A	probably damaging	Het
Unc13b	C	A	4: 43,177,995	S2941*	probably null	Het
Utrn	T	A	10: 12,478,424	H2806L	possibly damaging	Het
Vmn1r40	C	A	6: 89,714,606	A135D	probably damaging	Het
Vmn1r68	C	T	7: 10,527,689	V161M	probably benign	Het
Wiz	T	A	17: 32,387,600	I54F	probably damaging	Het

Other mutations in Megf10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Megf10	APN	18	57240628	missense	probably damaging	1.00
IGL00736:Megf10	APN	18	57292710	missense	probably benign	0.35
IGL01631:Megf10	APN	18	57259797	missense	possibly damaging	0.61
IGL02488:Megf10	APN	18	57292632	missense	probably damaging	1.00
IGL02747:Megf10	APN	18	57290493	missense	probably benign	0.43
IGL03298:Megf10	APN	18	57283838	nonsense	probably null
deep	UTSW	18	57262131	missense	probably damaging	1.00
megalodon	UTSW	18	57287976	nonsense	probably null
sharkie	UTSW	18	57191185	nonsense	probably null
IGL03046:Megf10	UTSW	18	57287983	missense	possibly damaging	0.95
PIT4696001:Megf10	UTSW	18	57277688	missense	probably damaging	1.00
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0020:Megf10	UTSW	18	57287893	missense	possibly damaging	0.81
R0115:Megf10	UTSW	18	57259802	missense	possibly damaging	0.67
R0455:Megf10	UTSW	18	57252982	missense	probably benign	0.34
R0602:Megf10	UTSW	18	57262100	missense	probably damaging	0.98
R0630:Megf10	UTSW	18	57287995	missense	probably benign	0.14
R0652:Megf10	UTSW	18	57277724	missense	probably benign	0.00
R0658:Megf10	UTSW	18	57252896	missense	probably benign	0.00
R0761:Megf10	UTSW	18	57287976	nonsense	probably null
R1013:Megf10	UTSW	18	57261219	missense	probably benign	0.00
R1130:Megf10	UTSW	18	57262006	missense	probably benign	0.06
R1451:Megf10	UTSW	18	57252859	missense	probably damaging	0.97
R1699:Megf10	UTSW	18	57277730	splice site	probably null
R1729:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1784:Megf10	UTSW	18	57240792	critical splice donor site	probably null
R1870:Megf10	UTSW	18	57191185	nonsense	probably null
R1961:Megf10	UTSW	18	57212354	missense	probably damaging	0.97
R2094:Megf10	UTSW	18	57281713	nonsense	probably null
R2213:Megf10	UTSW	18	57288009	nonsense	probably null
R2853:Megf10	UTSW	18	57293931	missense	probably damaging	1.00
R3772:Megf10	UTSW	18	57283862	missense	probably benign	0.39
R3774:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3775:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3776:Megf10	UTSW	18	57277105	missense	probably damaging	1.00
R3858:Megf10	UTSW	18	57275835	splice site	probably benign
R3911:Megf10	UTSW	18	57289393	missense	probably damaging	0.99
R3966:Megf10	UTSW	18	57180574	missense	probably damaging	1.00
R4043:Megf10	UTSW	18	57259798	missense	probably damaging	0.98
R4131:Megf10	UTSW	18	57180535	missense	probably damaging	1.00
R4598:Megf10	UTSW	18	57189603	critical splice donor site	probably null
R4598:Megf10	UTSW	18	57287812	missense	probably damaging	1.00
R4726:Megf10	UTSW	18	57287792	missense	probably benign	0.32
R4765:Megf10	UTSW	18	57287794	missense	possibly damaging	0.56
R4874:Megf10	UTSW	18	57293858	missense	probably benign	0.00
R4928:Megf10	UTSW	18	57240673	missense	probably benign
R5412:Megf10	UTSW	18	57191147	missense	probably damaging	0.99
R5901:Megf10	UTSW	18	57277108	missense	probably benign	0.11
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6036:Megf10	UTSW	18	57242727	missense	probably damaging	1.00
R6041:Megf10	UTSW	18	57180549	missense	probably benign
R6369:Megf10	UTSW	18	57261187	missense	probably benign	0.06
R6479:Megf10	UTSW	18	57246570	missense	possibly damaging	0.76
R6489:Megf10	UTSW	18	57291807	missense	probably benign	0.01
R7228:Megf10	UTSW	18	57189589	missense	probably damaging	1.00
R7296:Megf10	UTSW	18	57275753	missense	probably damaging	1.00
R7437:Megf10	UTSW	18	57262131	missense	probably damaging	1.00
R7461:Megf10	UTSW	18	57252853	missense	probably damaging	0.98
R7488:Megf10	UTSW	18	57191115	missense	probably damaging	0.99
R7492:Megf10	UTSW	18	57291794	missense	probably benign	0.00
R7542:Megf10	UTSW	18	57189570	missense	probably benign	0.07
R7636:Megf10	UTSW	18	57276989	missense	possibly damaging	0.85
R7646:Megf10	UTSW	18	57293999	unclassified	probably benign
R7650:Megf10	UTSW	18	57293999	unclassified	probably benign
R7713:Megf10	UTSW	18	57293999	unclassified	probably benign
R7714:Megf10	UTSW	18	57293999	unclassified	probably benign
R7716:Megf10	UTSW	18	57293999	unclassified	probably benign
R7796:Megf10	UTSW	18	57277659	missense	possibly damaging	0.85
R7915:Megf10	UTSW	18	57240735	missense	probably benign	0.05
R8221:Megf10	UTSW	18	57283821	missense	probably benign	0.00
R8527:Megf10	UTSW	18	57292718	missense	probably benign	0.00
R8559:Megf10	UTSW	18	57240627	missense	probably damaging	1.00
R9117:Megf10	UTSW	18	57259701	missense	probably damaging	1.00
R9337:Megf10	UTSW	18	57261180	nonsense	probably null
R9481:Megf10	UTSW	18	57262018	missense	probably benign	0.38
R9644:Megf10	UTSW	18	57242701	missense	probably benign
RF003:Megf10	UTSW	18	57294027	unclassified	probably benign
Z1176:Megf10	UTSW	18	57277694	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GACGAATGTCCTGTTGGGAG -3'
(R):5'- TGTCACACAAGCCTTCTTTTAGG -3'

Sequencing Primer
(F):5'- ACGAATGTCCTGTTGGGAGCTATG -3'
(R):5'- TTAGGGAAAAGTTCTGTTAATCTCAG -3'

Posted On

2017-06-26