Incidental Mutation 'R6016:Entpd2'
ID478586
Institutional Source Beutler Lab
Gene Symbol Entpd2
Ensembl Gene ENSMUSG00000015085
Gene Nameectonucleoside triphosphate diphosphohydrolase 2
SynonymsCd39l1, NTPDase2
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location25395874-25401321 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25398556 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 191 (R191W)
Ref Sequence ENSEMBL: ENSMUSP00000028328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028328] [ENSMUST00000055921] [ENSMUST00000071442] [ENSMUST00000141567] [ENSMUST00000154809]
Predicted Effect probably damaging
Transcript: ENSMUST00000028328
AA Change: R191W

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028328
Gene: ENSMUSG00000015085
AA Change: R191W

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:GDA1_CD39 32 459 9.7e-104 PFAM
low complexity region 465 483 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055921
SMART Domains Protein: ENSMUSP00000049602
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 341 9.1e-234 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071442
SMART Domains Protein: ENSMUSP00000071387
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 332 7.2e-217 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141106
Predicted Effect probably benign
Transcript: ENSMUST00000141567
SMART Domains Protein: ENSMUSP00000116275
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 231 7.8e-141 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148859
Predicted Effect probably benign
Transcript: ENSMUST00000154809
SMART Domains Protein: ENSMUSP00000123386
Gene: ENSMUSG00000015094

DomainStartEndE-ValueType
Pfam:NPDC1 1 142 1.8e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156824
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the type 2 enzyme of the ecto-nucleoside triphosphate diphosphohydrolase family (E-NTPDase). E-NTPDases are a family of ecto-nucleosidases that hydrolyze 5'-triphosphates. This ecto-ATPase is an integral membrane protein. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display smaller circumvallate papilla size and reduced neural responses to taste stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Entpd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Entpd2 APN 2 25398734 missense probably benign
IGL02869:Entpd2 APN 2 25398108 missense probably damaging 1.00
IGL03170:Entpd2 APN 2 25399481 missense probably damaging 1.00
R1280:Entpd2 UTSW 2 25399484 missense probably damaging 1.00
R2258:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2260:Entpd2 UTSW 2 25398087 missense probably damaging 1.00
R2420:Entpd2 UTSW 2 25399283 missense probably benign
R2566:Entpd2 UTSW 2 25399283 missense probably benign 0.16
R4802:Entpd2 UTSW 2 25399764 splice site probably null
R4938:Entpd2 UTSW 2 25399417 missense probably benign 0.25
R5239:Entpd2 UTSW 2 25400818 missense probably damaging 0.96
R5374:Entpd2 UTSW 2 25399726 missense probably damaging 1.00
R5739:Entpd2 UTSW 2 25399492 missense possibly damaging 0.90
R5752:Entpd2 UTSW 2 25399769 unclassified probably benign
R5881:Entpd2 UTSW 2 25400812 missense probably damaging 1.00
R6120:Entpd2 UTSW 2 25399466 missense probably benign 0.03
R6370:Entpd2 UTSW 2 25397417 missense probably damaging 1.00
R7301:Entpd2 UTSW 2 25400909 missense possibly damaging 0.88
R8059:Entpd2 UTSW 2 25398084 missense probably damaging 0.98
R8257:Entpd2 UTSW 2 25398121 missense probably damaging 1.00
R8868:Entpd2 UTSW 2 25399713 missense probably benign 0.01
RF007:Entpd2 UTSW 2 25400895 frame shift probably null
RF017:Entpd2 UTSW 2 25400895 frame shift probably null
RF018:Entpd2 UTSW 2 25400895 frame shift probably null
RF023:Entpd2 UTSW 2 25400895 frame shift probably null
RF024:Entpd2 UTSW 2 25400895 frame shift probably null
X0009:Entpd2 UTSW 2 25398679 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCACACGGTACCCCTTTGAC -3'
(R):5'- TTGTAGACACACCTGGAGGG -3'

Sequencing Primer
(F):5'- TTGACTTCCGTGGTGCCCG -3'
(R):5'- CAGAAGCCTCTGGAGAACCTG -3'
Posted On2017-06-26