Incidental Mutation 'R6016:Casz1'
ID478595
Institutional Source Beutler Lab
Gene Symbol Casz1
Ensembl Gene ENSMUSG00000028977
Gene Namecastor zinc finger 1
SynonymsD4Ertd432e, 2410019P08Rik, Cst, castor
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location148804429-148954889 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 148934584 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 447 (N447K)
Ref Sequence ENSEMBL: ENSMUSP00000112978 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094464] [ENSMUST00000122222] [ENSMUST00000139806] [ENSMUST00000147270]
Predicted Effect probably damaging
Transcript: ENSMUST00000094464
AA Change: N447K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092035
Gene: ENSMUSG00000028977
AA Change: N447K

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122222
AA Change: N447K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112978
Gene: ENSMUSG00000028977
AA Change: N447K

DomainStartEndE-ValueType
low complexity region 403 420 N/A INTRINSIC
ZnF_C2H2 489 514 5.34e0 SMART
ZnF_C2H2 550 574 8.09e-1 SMART
ZnF_C2H2 609 633 9.3e-1 SMART
low complexity region 643 658 N/A INTRINSIC
ZnF_C2H2 667 691 1.1e-2 SMART
low complexity region 698 711 N/A INTRINSIC
low complexity region 728 766 N/A INTRINSIC
low complexity region 796 807 N/A INTRINSIC
low complexity region 810 834 N/A INTRINSIC
low complexity region 875 890 N/A INTRINSIC
low complexity region 951 957 N/A INTRINSIC
ZnF_C2H2 1031 1055 2.29e1 SMART
low complexity region 1080 1091 N/A INTRINSIC
low complexity region 1105 1115 N/A INTRINSIC
ZnF_C2H2 1182 1206 1.59e1 SMART
ZnF_C2H2 1242 1266 2.47e1 SMART
ZnF_C2H2 1300 1324 3.47e0 SMART
ZnF_C2H2 1457 1481 7.89e0 SMART
ZnF_C2H2 1515 1537 3.21e1 SMART
ZnF_C2H2 1571 1595 3.99e0 SMART
low complexity region 1632 1649 N/A INTRINSIC
SCOP:d1qbkb_ 1675 1742 2e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000139806
AA Change: N161K

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000120307
Gene: ENSMUSG00000028977
AA Change: N161K

DomainStartEndE-ValueType
low complexity region 117 134 N/A INTRINSIC
ZnF_C2H2 203 228 5.34e0 SMART
ZnF_C2H2 264 288 8.09e-1 SMART
ZnF_C2H2 323 347 9.3e-1 SMART
low complexity region 357 372 N/A INTRINSIC
ZnF_C2H2 381 405 1.1e-2 SMART
low complexity region 412 425 N/A INTRINSIC
low complexity region 442 480 N/A INTRINSIC
low complexity region 510 521 N/A INTRINSIC
low complexity region 524 548 N/A INTRINSIC
low complexity region 589 604 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147270
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a zinc finger transcription factor. The encoded protein may function as a tumor suppressor, and single nucleotide polymorphisms in this gene are associated with blood pressure variation. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete lethality throughout fetal growth and development and abnormal heart development associated with edema, decreased fetal cardiomyocyte proliferation, myocardium hypoplasia, ventricular septal defect, and altered heart shape and Z line formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Lats2 A T 14: 57,734,175 N14K probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Casz1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00914:Casz1 APN 4 148929371 missense probably damaging 1.00
IGL02137:Casz1 APN 4 148933468 missense possibly damaging 0.71
IGL02176:Casz1 APN 4 148934619 missense probably damaging 1.00
IGL02629:Casz1 APN 4 148944391 missense probably benign 0.01
IGL02871:Casz1 APN 4 148944319 missense possibly damaging 0.93
FR4340:Casz1 UTSW 4 148952302 small deletion probably benign
H8562:Casz1 UTSW 4 148933451 missense probably damaging 1.00
R0090:Casz1 UTSW 4 148933411 missense probably benign 0.00
R0389:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0443:Casz1 UTSW 4 148948911 missense possibly damaging 0.83
R0550:Casz1 UTSW 4 148952284 small deletion probably benign
R0597:Casz1 UTSW 4 148944394 missense probably benign 0.00
R1117:Casz1 UTSW 4 148934595 missense probably damaging 1.00
R1476:Casz1 UTSW 4 148946171 missense probably benign 0.05
R1540:Casz1 UTSW 4 148942900 unclassified probably benign
R1610:Casz1 UTSW 4 148929087 missense possibly damaging 0.54
R1764:Casz1 UTSW 4 148942900 unclassified probably benign
R1779:Casz1 UTSW 4 148932937 missense probably benign 0.00
R1874:Casz1 UTSW 4 148943211 missense probably damaging 0.99
R1902:Casz1 UTSW 4 148936195 missense possibly damaging 0.95
R1914:Casz1 UTSW 4 148932958 missense probably damaging 1.00
R2126:Casz1 UTSW 4 148946064 missense probably damaging 0.99
R2261:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R2262:Casz1 UTSW 4 148929099 missense probably damaging 0.96
R3874:Casz1 UTSW 4 148939589 intron probably benign
R4019:Casz1 UTSW 4 148932878 missense probably benign 0.00
R4355:Casz1 UTSW 4 148952335 missense unknown
R4420:Casz1 UTSW 4 148948918 missense possibly damaging 0.90
R4610:Casz1 UTSW 4 148933267 missense probably damaging 1.00
R4632:Casz1 UTSW 4 148951855 missense possibly damaging 0.71
R4762:Casz1 UTSW 4 148938981 missense probably damaging 1.00
R4824:Casz1 UTSW 4 148944571 missense probably damaging 1.00
R4907:Casz1 UTSW 4 148944541 missense probably damaging 1.00
R5628:Casz1 UTSW 4 148946096 missense probably damaging 1.00
R5736:Casz1 UTSW 4 148929410 missense probably benign 0.00
R5929:Casz1 UTSW 4 148938696 missense probably damaging 1.00
R5929:Casz1 UTSW 4 148938969 missense probably damaging 1.00
R5932:Casz1 UTSW 4 148939113 missense possibly damaging 0.52
R6019:Casz1 UTSW 4 148947038 missense probably damaging 0.99
R6139:Casz1 UTSW 4 148951697 missense probably damaging 1.00
R6223:Casz1 UTSW 4 148933383 missense probably damaging 1.00
R6239:Casz1 UTSW 4 148938277 missense probably damaging 1.00
R6323:Casz1 UTSW 4 148941704 missense possibly damaging 0.89
R6354:Casz1 UTSW 4 148952542 missense unknown
R6454:Casz1 UTSW 4 148951495 missense probably damaging 0.99
R6479:Casz1 UTSW 4 148937078 missense probably damaging 1.00
R6529:Casz1 UTSW 4 148938189 missense probably damaging 1.00
R6772:Casz1 UTSW 4 148943206 missense probably damaging 1.00
R7000:Casz1 UTSW 4 148929236 missense probably damaging 1.00
R7152:Casz1 UTSW 4 148901291 start gained probably benign
R7324:Casz1 UTSW 4 148947033 missense probably damaging 0.99
R7339:Casz1 UTSW 4 148951745 missense probably damaging 1.00
R7388:Casz1 UTSW 4 148952393 missense unknown
R7480:Casz1 UTSW 4 148944586 missense probably damaging 0.99
R7719:Casz1 UTSW 4 148944524 missense probably damaging 0.99
R7789:Casz1 UTSW 4 148929406 missense probably benign
R7801:Casz1 UTSW 4 148938249 missense probably damaging 0.99
R7815:Casz1 UTSW 4 148929305 missense possibly damaging 0.89
R7818:Casz1 UTSW 4 148946076 missense probably damaging 1.00
RF001:Casz1 UTSW 4 148952304 small deletion probably benign
RF063:Casz1 UTSW 4 148952304 small deletion probably benign
X0018:Casz1 UTSW 4 148939008 missense probably damaging 1.00
X0064:Casz1 UTSW 4 148932952 missense probably damaging 0.99
Z1088:Casz1 UTSW 4 148944359 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTCAGAGATGGGCTAACTGAG -3'
(R):5'- GATGTAGAGAAAGCAGCCCC -3'

Sequencing Primer
(F):5'- TAACTGAGCTCCTCTGGGC -3'
(R):5'- TTTGCCCTGGGGACAAACTAATAC -3'
Posted On2017-06-26