Mutagenetix > Incidental Mutation

Incidental Mutation 'R6016:Pes1'

478606

Institutional Source

Beutler Lab

Gene Symbol

Pes1

Ensembl Gene

ENSMUSG00000020430

Gene Name

pescadillo ribosomal biogenesis factor 1

Synonyms

MMRRC Submission

043255-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6016 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3963975-3980004 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 3978004 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 552 (M552K)

Ref Sequence

ENSEMBL: ENSMUSP00000105612 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]

AlphaFold

Q9EQ61

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020705
AA Change: M548K

PolyPhen 2 Score 0.633 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430
AA Change: M548K

Domain	Start	End	E-Value	Type
Pfam:Pescadillo_N	6	286	5.1e-135	PFAM
BRCT	323	404	4.81e-7	SMART
coiled coil region	469	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000042344

SMART Domains

Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493

Domain	Start	End	E-Value	Type
low complexity region	23	40	N/A	INTRINSIC
low complexity region	84	93	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000109985
AA Change: M552K

PolyPhen 2 Score 0.679 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430
AA Change: M552K

Domain	Start	End	E-Value	Type
Pfam:Pescadillo_N	7	284	1.1e-130	PFAM
BRCT	327	408	4.81e-7	SMART
coiled coil region	473	546	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137544

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that contains a breast cancer associated gene 1 (BRCA1) C-terminal interaction domain. The encoded protein interacts with BOP1 and WDR12 to form the PeBoW complex, which plays a critical role in cell proliferation via pre-rRNA processing and 60S ribosomal subunit maturation. Expression of this gene may play an important role in breast cancer proliferation and tumorigenicity. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. Pseudogenes of this gene are located on the long arm of chromosome 4 and the short arm of chromosome 9. [provided by RefSeq, Aug 2011]
PHENOTYPE: Targeted disuption of the mouse gene results in embryonic arrest at morula stages of development, as well as failure of nucleologenesis and disruption of ribosome biogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 32 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apol9b	T	C	15: 77,735,858	S285P	probably damaging	Het
Casz1	C	A	4: 148,934,584	N447K	probably damaging	Het
Cltb	T	C	13: 54,606,667	T71A	possibly damaging	Het
Dcaf12	A	G	4: 41,313,267	F93L	probably damaging	Het
Dnah5	T	C	15: 28,327,884	Y2135H	probably damaging	Het
Entpd2	C	T	2: 25,398,556	R191W	probably damaging	Het
Gm17067	G	T	7: 42,708,230	P283T	probably benign	Het
Gm3250	A	G	10: 77,782,533		probably benign	Het
Gne	T	C	4: 44,039,063	E532G	probably damaging	Het
Gsdmc3	T	G	15: 63,868,412	D86A	probably benign	Het
Hs3st2	A	G	7: 121,500,699	H256R	probably damaging	Het
Il19	T	A	1: 130,935,981	D16V	probably damaging	Het
Lats2	A	T	14: 57,734,175	N14K	probably damaging	Het
Mill2	G	T	7: 18,856,448	S151I	probably benign	Het
Ncapg2	G	A	12: 116,426,607	R392H	probably damaging	Het
Nop56	T	C	2: 130,276,625		probably null	Het
Olfr1344	A	T	7: 6,440,614	H238L	probably benign	Het
Olfr467	A	T	7: 107,815,012	I143F	probably benign	Het
Olfr761	A	T	17: 37,952,076	V316D	probably benign	Het
Pde1a	T	C	2: 79,865,062	R446G	probably benign	Het
Plxnb2	T	A	15: 89,161,022	T1074S	possibly damaging	Het
Psg23	G	T	7: 18,612,187	H194Q	probably benign	Het
Rprd2	A	G	3: 95,787,373	V116A	probably damaging	Het
Shkbp1	A	G	7: 27,354,401	V124A	possibly damaging	Het
Slc38a8	A	T	8: 119,494,305		probably null	Het
Slitrk6	A	G	14: 110,750,526	V583A	probably benign	Het
Sptbn5	G	T	2: 120,050,092		noncoding transcript	Het
Stab1	A	T	14: 31,158,993	I614N	probably damaging	Het
Tgm6	A	G	2: 130,141,228	T246A	probably damaging	Het
Tnks1bp1	T	C	2: 85,052,390	L187P	probably damaging	Het
Vmn1r157	A	G	7: 22,761,847	R51G	possibly damaging	Het
Vmn2r68	A	T	7: 85,222,245	I610K	probably damaging	Het

Other mutations in Pes1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00272:Pes1	APN	11	3976803	missense	probably damaging	1.00
IGL01448:Pes1	APN	11	3977979	missense	possibly damaging	0.89
H8441:Pes1	UTSW	11	3977636	small deletion	probably benign
R0634:Pes1	UTSW	11	3977794	splice site	probably benign
R0634:Pes1	UTSW	11	3977795	splice site	probably benign
R0883:Pes1	UTSW	11	3975557	missense	probably damaging	1.00
R0980:Pes1	UTSW	11	3977636	small deletion	probably benign
R1435:Pes1	UTSW	11	3976075	missense	probably benign	0.00
R1557:Pes1	UTSW	11	3976824	missense	probably damaging	1.00
R1694:Pes1	UTSW	11	3977719	small deletion	probably benign
R1885:Pes1	UTSW	11	3969482	missense	probably damaging	1.00
R1929:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2270:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2272:Pes1	UTSW	11	3969524	missense	probably damaging	1.00
R2362:Pes1	UTSW	11	3977123	missense	probably damaging	1.00
R2869:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2869:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2870:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2870:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2871:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2871:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R2873:Pes1	UTSW	11	3976834	missense	probably benign	0.05
R3024:Pes1	UTSW	11	3977719	small deletion	probably benign
R3039:Pes1	UTSW	11	3975547	missense	probably damaging	1.00
R3195:Pes1	UTSW	11	3975736	splice site	probably benign
R3773:Pes1	UTSW	11	3975548	missense	probably damaging	1.00
R4590:Pes1	UTSW	11	3977986	missense	probably damaging	1.00
R4739:Pes1	UTSW	11	3964058	missense	probably damaging	1.00
R5396:Pes1	UTSW	11	3977719	small deletion	probably benign
R6351:Pes1	UTSW	11	3978865	missense	probably benign
R6921:Pes1	UTSW	11	3973330	missense	probably damaging	0.98
R7315:Pes1	UTSW	11	3976085	missense	probably benign	0.00
R8178:Pes1	UTSW	11	3977718	missense	probably benign
R9599:Pes1	UTSW	11	3976118	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAGGCCACGTTCACATGCAG -3'
(R):5'- CCATCCACAGGACAGCTATG -3'

Sequencing Primer
(F):5'- GATGCACTGTTCCCCAGAAAC -3'
(R):5'- AAGACCTAGGTTTCTATTCCCAGG -3'

Posted On

2017-06-26