Incidental Mutation 'R6016:Lats2'
ID478610
Institutional Source Beutler Lab
Gene Symbol Lats2
Ensembl Gene ENSMUSG00000021959
Gene Namelarge tumor suppressor 2
Synonyms
MMRRC Submission 043255-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6016 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location57689662-57758388 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 57734175 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 14 (N14K)
Ref Sequence ENSEMBL: ENSMUSP00000133680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022531] [ENSMUST00000038381] [ENSMUST00000077981] [ENSMUST00000173732] [ENSMUST00000173990] [ENSMUST00000174166] [ENSMUST00000174213] [ENSMUST00000174694]
Predicted Effect probably damaging
Transcript: ENSMUST00000022531
AA Change: N14K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022531
Gene: ENSMUSG00000021959
AA Change: N14K

DomainStartEndE-ValueType
PDB:2COS|A 91 138 3e-20 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 931 2.94e-94 SMART
S_TK_X 932 1002 1.21e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000038381
AA Change: N14K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000077981
AA Change: N14K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173077
Predicted Effect probably benign
Transcript: ENSMUST00000173732
Predicted Effect probably damaging
Transcript: ENSMUST00000173990
AA Change: N14K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133976
Gene: ENSMUSG00000021959
AA Change: N14K

DomainStartEndE-ValueType
PDB:2COS|A 91 138 8e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
S_TKc 626 893 7.75e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174166
AA Change: N14K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133379
Gene: ENSMUSG00000021959
AA Change: N14K

DomainStartEndE-ValueType
PDB:2COS|A 91 114 5e-7 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000174213
AA Change: N14K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134321
Gene: ENSMUSG00000021959
AA Change: N14K

DomainStartEndE-ValueType
PDB:2COS|A 91 114 2e-6 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000174694
AA Change: N14K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133680
Gene: ENSMUSG00000114942
AA Change: N14K

DomainStartEndE-ValueType
PDB:2COS|A 91 138 7e-22 PDB
low complexity region 210 223 N/A INTRINSIC
low complexity region 401 408 N/A INTRINSIC
low complexity region 437 444 N/A INTRINSIC
low complexity region 471 482 N/A INTRINSIC
low complexity region 517 529 N/A INTRINSIC
Pfam:Pkinase 626 792 2.2e-38 PFAM
Pfam:Pkinase_Tyr 626 795 2.8e-21 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine protein kinase belonging to the LATS tumor suppressor family. The protein localizes to centrosomes during interphase, and early and late metaphase. It interacts with the centrosomal proteins aurora-A and ajuba and is required for accumulation of gamma-tubulin and spindle formation at the onset of mitosis. It also interacts with a negative regulator of p53 and may function in a positive feedback loop with p53 that responds to cytoskeleton damage. Additionally, it can function as a co-repressor of androgen-responsive gene expression. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display embryonic lethality with decreased cell proliferation, chromosomal instability, atrial hyperplasia, ventricular hypoplasia, delayed embryonic development, an irregular kinked neural tube, and hemorrhages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol9b T C 15: 77,735,858 S285P probably damaging Het
Casz1 C A 4: 148,934,584 N447K probably damaging Het
Cltb T C 13: 54,606,667 T71A possibly damaging Het
Dcaf12 A G 4: 41,313,267 F93L probably damaging Het
Dnah5 T C 15: 28,327,884 Y2135H probably damaging Het
Entpd2 C T 2: 25,398,556 R191W probably damaging Het
Gm17067 G T 7: 42,708,230 P283T probably benign Het
Gm3250 A G 10: 77,782,533 probably benign Het
Gne T C 4: 44,039,063 E532G probably damaging Het
Gsdmc3 T G 15: 63,868,412 D86A probably benign Het
Hs3st2 A G 7: 121,500,699 H256R probably damaging Het
Il19 T A 1: 130,935,981 D16V probably damaging Het
Mill2 G T 7: 18,856,448 S151I probably benign Het
Ncapg2 G A 12: 116,426,607 R392H probably damaging Het
Nop56 T C 2: 130,276,625 probably null Het
Olfr1344 A T 7: 6,440,614 H238L probably benign Het
Olfr467 A T 7: 107,815,012 I143F probably benign Het
Olfr761 A T 17: 37,952,076 V316D probably benign Het
Pde1a T C 2: 79,865,062 R446G probably benign Het
Pes1 T A 11: 3,978,004 M552K possibly damaging Het
Plxnb2 T A 15: 89,161,022 T1074S possibly damaging Het
Psg23 G T 7: 18,612,187 H194Q probably benign Het
Rprd2 A G 3: 95,787,373 V116A probably damaging Het
Shkbp1 A G 7: 27,354,401 V124A possibly damaging Het
Slc38a8 A T 8: 119,494,305 probably null Het
Slitrk6 A G 14: 110,750,526 V583A probably benign Het
Sptbn5 G T 2: 120,050,092 noncoding transcript Het
Stab1 A T 14: 31,158,993 I614N probably damaging Het
Tgm6 A G 2: 130,141,228 T246A probably damaging Het
Tnks1bp1 T C 2: 85,052,390 L187P probably damaging Het
Vmn1r157 A G 7: 22,761,847 R51G possibly damaging Het
Vmn2r68 A T 7: 85,222,245 I610K probably damaging Het
Other mutations in Lats2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Lats2 APN 14 57691569 missense probably benign 0.09
IGL02104:Lats2 APN 14 57734012 missense probably damaging 1.00
IGL02173:Lats2 APN 14 57697260 missense probably damaging 1.00
IGL02377:Lats2 APN 14 57691595 missense probably damaging 1.00
IGL02995:Lats2 APN 14 57700348 missense probably damaging 1.00
R6846_Lats2_781 UTSW 14 57696134 missense probably damaging 1.00
PIT4472001:Lats2 UTSW 14 57699357 nonsense probably null
R0653:Lats2 UTSW 14 57700196 nonsense probably null
R0780:Lats2 UTSW 14 57691296 missense probably damaging 1.00
R1129:Lats2 UTSW 14 57700333 missense possibly damaging 0.71
R1851:Lats2 UTSW 14 57697455 missense probably damaging 1.00
R1882:Lats2 UTSW 14 57697354 missense probably damaging 1.00
R2184:Lats2 UTSW 14 57691559 missense probably damaging 0.99
R3498:Lats2 UTSW 14 57722466 missense possibly damaging 0.95
R3692:Lats2 UTSW 14 57691541 missense probably damaging 1.00
R4212:Lats2 UTSW 14 57696255 missense possibly damaging 0.82
R4357:Lats2 UTSW 14 57699383 missense probably damaging 1.00
R4962:Lats2 UTSW 14 57699592 missense probably damaging 1.00
R5394:Lats2 UTSW 14 57691353 missense probably benign 0.10
R5477:Lats2 UTSW 14 57699553 missense probably benign 0.00
R5729:Lats2 UTSW 14 57722735 missense probably benign 0.04
R5802:Lats2 UTSW 14 57694418 missense probably damaging 0.99
R5931:Lats2 UTSW 14 57696131 missense probably damaging 1.00
R6376:Lats2 UTSW 14 57722509 missense probably benign 0.00
R6624:Lats2 UTSW 14 57694312 critical splice donor site probably null
R6638:Lats2 UTSW 14 57699365 missense probably damaging 1.00
R6846:Lats2 UTSW 14 57696134 missense probably damaging 1.00
R7198:Lats2 UTSW 14 57697125 missense probably damaging 1.00
R7233:Lats2 UTSW 14 57722694 splice site probably null
R7883:Lats2 UTSW 14 57697200 missense probably damaging 1.00
R8081:Lats2 UTSW 14 57700511 missense probably damaging 1.00
R8508:Lats2 UTSW 14 57722705 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATAAGGTCCAAACTTCGGGG -3'
(R):5'- TCAGAGAGTGATGGTCTTCAAAATG -3'

Sequencing Primer
(F):5'- AAACTTCGGGGTGGCTCTC -3'
(R):5'- GATGGTCTTCAAAATGAAAACTCTGG -3'
Posted On2017-06-26