Incidental Mutation 'R6017:Arpc2'
ID478618
Institutional Source Beutler Lab
Gene Symbol Arpc2
Ensembl Gene ENSMUSG00000006304
Gene Nameactin related protein 2/3 complex, subunit 2
Synonymsp34-Arc, 2210023N03Rik
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6017 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location74236084-74268209 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 74262486 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 193 (H193N)
Ref Sequence ENSEMBL: ENSMUSP00000109451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006467] [ENSMUST00000113819] [ENSMUST00000113820]
Predicted Effect probably benign
Transcript: ENSMUST00000006467
AA Change: H193N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000006467
Gene: ENSMUSG00000006304
AA Change: H193N

DomainStartEndE-ValueType
Pfam:P34-Arc 57 284 3.7e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113819
AA Change: H177N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109450
Gene: ENSMUSG00000006304
AA Change: H177N

DomainStartEndE-ValueType
Pfam:P34-Arc 40 270 4.3e-107 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113820
AA Change: H193N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109451
Gene: ENSMUSG00000006304
AA Change: H193N

DomainStartEndE-ValueType
Pfam:P34-Arc 56 286 4.2e-106 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of seven subunits of the human Arp2/3 protein complex. The Arp2/3 protein complex has been implicated in the control of actin polymerization in cells and has been conserved through evolution. The exact role of the protein encoded by this gene, the p34 subunit, has yet to be determined. Two alternatively spliced variants have been characterized to date. Additional alternatively spliced variants have been described but their full length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Arpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Arpc2 APN 1 74248179 missense probably benign
R0220:Arpc2 UTSW 1 74248134 missense probably damaging 1.00
R0364:Arpc2 UTSW 1 74236887 missense probably null
R1695:Arpc2 UTSW 1 74248232 missense probably damaging 0.97
R4183:Arpc2 UTSW 1 74248163 missense probably damaging 0.99
R5144:Arpc2 UTSW 1 74248208 missense probably damaging 1.00
R5438:Arpc2 UTSW 1 74236836 missense probably null 1.00
R5775:Arpc2 UTSW 1 74255949 splice site probably null
R7173:Arpc2 UTSW 1 74264372 missense probably damaging 1.00
R7683:Arpc2 UTSW 1 74263814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTGCACTGAAAGCGGCTAG -3'
(R):5'- TTAAGTTCGCCTAGATGTGGGC -3'

Sequencing Primer
(F):5'- AGCACTCCTTGTACCTGAGG -3'
(R):5'- CACCCTGCCATGAAGGTTTTGG -3'
Posted On2017-06-26