Mutagenetix > Incidental Mutations

Incidental Mutation 'R6017:Epha8'

478629

Institutional Source

Beutler Lab

Gene Symbol

Epha8

Ensembl Gene

ENSMUSG00000028661

Gene Name

Eph receptor A8

Synonyms

EphA8, Hek3, Eek

MMRRC Submission

044191-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6017 (G1)

Quality Score

159.009

Status

Validated

Chromosome

Chromosomal Location

136929419-136956816 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 136931743 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Asparagine at position 867 (H867N)

Ref Sequence

ENSEMBL: ENSMUSP00000030420 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030420]

Predicted Effect

probably damaging
Transcript: ENSMUST00000030420
AA Change: H867N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000030420
Gene: ENSMUSG00000028661
AA Change: H867N

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
EPH_lbd	30	203	2.59e-116	SMART
FN3	328	418	4.03e-6	SMART
FN3	439	520	1.67e-12	SMART
Pfam:EphA2_TM	542	631	5.8e-10	PFAM
TyrKc	634	891	1.03e-125	SMART
SAM	926	993	4.74e-19	SMART

Meta Mutation Damage Score

0.7414

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.0%
20x: 90.5%

Validation Efficiency

97% (62/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. The protein encoded by this gene functions as a receptor for ephrin A2, A3 and A5 and plays a role in short-range contact-mediated axonal guidance during development of the mammalian nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation are viable, fertile, and grossly normal but exhibit a commissural defect, whereby tectal axons fail to project from the superior colliculus of the midbrain to the contralateral inferior colliculus and instead project to the ipsilateral cervical spinal cord. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9030624J02Rik	T	A	7: 118,809,921	V635D	probably damaging	Het
Adgb	T	C	10: 10,450,036	I56M	probably damaging	Het
Adgrv1	A	T	13: 81,397,423	L5581*	probably null	Het
Arpc2	C	A	1: 74,262,486	H193N	probably benign	Het
B3galt5	A	G	16: 96,315,184	T6A	probably benign	Het
Bod1l	A	T	5: 41,818,760	V1737E	probably benign	Het
Cacfd1	T	G	2: 27,013,428		probably benign	Het
Cdc42ep4	A	T	11: 113,729,366	D66E	probably benign	Het
Cldn1	G	T	16: 26,363,219	T80N	probably damaging	Het
Cmtm1	C	A	8: 104,310,951		probably benign	Het
Cntnap5c	A	T	17: 58,104,698	I526F	probably benign	Het
Copb1	T	C	7: 114,236,797	K450E	probably benign	Het
Crebrf	A	C	17: 26,757,849	I416L	probably benign	Het
Csmd3	C	A	15: 48,314,012	V377F	possibly damaging	Het
Cyp1a2	T	C	9: 57,681,030	K304E	probably damaging	Het
Cyp2d26	A	G	15: 82,790,573	S403P	possibly damaging	Het
Cyp4a12a	T	A	4: 115,326,279	C198*	probably null	Het
Ddx11	A	G	17: 66,130,017	D102G	probably benign	Het
Dpys	T	A	15: 39,846,718	Q105L	probably null	Het
Dsn1	C	A	2: 156,996,242	R334L	probably damaging	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ephb3	T	C	16: 21,222,031	L643P	probably damaging	Het
Fbxo44	G	T	4: 148,158,553	H83Q	probably benign	Het
Gm13102	T	C	4: 144,109,237	Y477H	possibly damaging	Het
Gm7347	T	C	5: 26,057,278	T82A	probably benign	Het
Gss	C	A	2: 155,587,465	A36S	probably benign	Het
Hepacam	A	G	9: 37,380,760	D128G	probably benign	Het
Hepacam2	C	A	6: 3,483,332	V226F	probably damaging	Het
Hgfac	T	C	5: 35,044,395	Y291H	probably damaging	Het
Ip6k2	G	A	9: 108,797,267	R88H	probably benign	Het
Irx5	T	A	8: 92,358,250	Y23N	probably damaging	Het
Kcnf1	T	C	12: 17,175,081	M380V	probably damaging	Het
Kcnj1	A	T	9: 32,394,104		probably benign	Het
Kcnk12	T	C	17: 87,746,736	E166G	probably damaging	Het
Kctd16	T	C	18: 40,258,943	C195R	probably damaging	Het
Kif28	T	A	1: 179,699,453	I718F	probably benign	Het
Lce1e	T	A	3: 92,707,933	K36*	probably null	Het
Map4	T	C	9: 110,034,619	L304P	probably benign	Het
Mettl17	C	T	14: 51,891,617		probably benign	Het
Mpp4	T	C	1: 59,121,359	D595G	probably damaging	Het
Myo18a	A	G	11: 77,841,523	K1282E	probably damaging	Het
Nf2	A	T	11: 4,816,137	V131D	possibly damaging	Het
Olfr147	A	T	9: 38,403,620	M249L	probably benign	Het
Olfr855	T	C	9: 19,585,434	V299A	probably benign	Het
Oxsr1	A	G	9: 119,264,777	L270S	probably benign	Het
Plekhg2	G	A	7: 28,362,884	T536I	probably damaging	Het
Ppp1r9a	T	A	6: 4,906,363	V306D	probably benign	Het
Ptk6	C	T	2: 181,195,812	C438Y	probably benign	Het
Scfd1	T	C	12: 51,445,678	V590A	probably damaging	Het
Serpina1b	A	G	12: 103,729,272	S337P	probably damaging	Het
Skor2	T	A	18: 76,858,927	C115S	unknown	Het
Slc2a7	T	C	4: 150,165,172	S407P	probably damaging	Het
Slc8a1	A	G	17: 81,648,254	S452P	probably damaging	Het
Spata31d1c	A	G	13: 65,035,079	D145G	possibly damaging	Het
Spata6	C	A	4: 111,774,827	T145K	probably damaging	Het
Stab1	C	T	14: 31,141,544	R2087H	probably benign	Het
Stk24	C	T	14: 121,302,245	V180M	probably benign	Het
Trrap	A	G	5: 144,844,241	T3271A	probably damaging	Het
Tyro3	T	A	2: 119,816,666	W755R	probably damaging	Het
Ush2a	T	C	1: 188,957,514		probably null	Het
Uts2b	T	C	16: 27,361,043		probably null	Het
Vmn2r105	T	A	17: 20,208,627	H729L	probably damaging	Het
Wdfy3	T	C	5: 101,851,359	I3068V	probably benign	Het
Zfp457	G	A	13: 67,293,699	H175Y	probably damaging	Het
Zfp758	A	G	17: 22,373,731	D40G	probably damaging	Het

Other mutations in Epha8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Epha8	APN	4	136945810	missense	probably damaging	1.00
IGL00960:Epha8	APN	4	136951839	splice site	probably null
IGL01124:Epha8	APN	4	136936083	missense	probably damaging	1.00
IGL01550:Epha8	APN	4	136931740	missense	possibly damaging	0.87
IGL01807:Epha8	APN	4	136931682	missense	probably benign	0.08
IGL01844:Epha8	APN	4	136931049	makesense	probably null
IGL02167:Epha8	APN	4	136931094	missense	probably damaging	1.00
R0255:Epha8	UTSW	4	136940286	missense	probably damaging	0.99
R0445:Epha8	UTSW	4	136932400	missense	probably damaging	1.00
R1757:Epha8	UTSW	4	136931478	splice site	probably null
R1911:Epha8	UTSW	4	136936314	missense	probably damaging	1.00
R1936:Epha8	UTSW	4	136940243	missense	probably benign	0.08
R2291:Epha8	UTSW	4	136933347	missense	probably damaging	1.00
R2359:Epha8	UTSW	4	136946032	missense	probably damaging	1.00
R2372:Epha8	UTSW	4	136933010	missense	probably damaging	1.00
R4581:Epha8	UTSW	4	136933464	missense	probably damaging	1.00
R4747:Epha8	UTSW	4	136938695	frame shift	probably null
R4784:Epha8	UTSW	4	136933322	missense	probably damaging	1.00
R5156:Epha8	UTSW	4	136938726	missense	probably benign	0.14
R5164:Epha8	UTSW	4	136945672	missense	possibly damaging	0.93
R5335:Epha8	UTSW	4	136931935	missense	probably damaging	1.00
R5480:Epha8	UTSW	4	136935130	missense	probably benign
R5552:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R5830:Epha8	UTSW	4	136936390	nonsense	probably null
R6450:Epha8	UTSW	4	136931899	missense	probably damaging	1.00
R6798:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R6799:Epha8	UTSW	4	136945669	missense	probably benign	0.00
R7060:Epha8	UTSW	4	136931158	missense	probably damaging	1.00
R7297:Epha8	UTSW	4	136945913	missense	probably damaging	1.00
R7344:Epha8	UTSW	4	136934538	missense	probably benign	0.14
R7467:Epha8	UTSW	4	136931088	missense	possibly damaging	0.90
R7563:Epha8	UTSW	4	136938789	missense	possibly damaging	0.77
R7826:Epha8	UTSW	4	136936187	missense	probably benign	0.09
R7845:Epha8	UTSW	4	136936401	missense	probably benign	0.04
R7863:Epha8	UTSW	4	136933655	missense	probably damaging	1.00
R7904:Epha8	UTSW	4	136931739	missense	possibly damaging	0.95
R7918:Epha8	UTSW	4	136934566	missense	probably benign	0.12
R8177:Epha8	UTSW	4	136945663	missense	probably benign	0.00
R8244:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8266:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8268:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8269:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8289:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8290:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8294:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8295:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8299:Epha8	UTSW	4	136938586	missense	probably damaging	0.98
R8445:Epha8	UTSW	4	136932289	missense	probably benign	0.13
RF025:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
RF054:Epha8	UTSW	4	136933037	critical splice acceptor site	probably benign
Z1176:Epha8	UTSW	4	136938696	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TTTGCTAAGGACGTGGGCAC -3'
(R):5'- TGGAACATGACCAACCAGGATG -3'

Sequencing Primer
(F):5'- GCACTGGCCACTCTTCG -3'
(R):5'- TGACCAACCAGGATGTGAGCC -3'

Posted On

2017-06-26