Incidental Mutation 'R6017:Hgfac'
ID478634
Institutional Source Beutler Lab
Gene Symbol Hgfac
Ensembl Gene ENSMUSG00000029102
Gene Namehepatocyte growth factor activator
SynonymsHGFA
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R6017 (G1)
Quality Score195.009
Status Validated
Chromosome5
Chromosomal Location35041509-35048461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 35044395 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 291 (Y291H)
Ref Sequence ENSEMBL: ENSMUSP00000030985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030985] [ENSMUST00000087684] [ENSMUST00000114283] [ENSMUST00000114285] [ENSMUST00000202573]
Predicted Effect probably damaging
Transcript: ENSMUST00000030985
AA Change: Y291H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030985
Gene: ENSMUSG00000029102
AA Change: Y291H

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 85 93 N/A INTRINSIC
FN2 98 145 7.31e-27 SMART
EGF 160 195 2.11e-4 SMART
Pfam:fn1 199 234 7.7e-11 PFAM
EGF 241 276 1.69e-3 SMART
KR 281 366 5.2e-36 SMART
Tryp_SPc 405 639 2.07e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087684
SMART Domains Protein: ENSMUSP00000084970
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
PDZ 29 98 5.25e-18 SMART
PTB 224 373 5.05e-28 SMART
low complexity region 443 456 N/A INTRINSIC
low complexity region 643 661 N/A INTRINSIC
low complexity region 685 697 N/A INTRINSIC
RGS 715 832 2.84e-41 SMART
Pfam:RGS12_us1 836 953 4.3e-61 PFAM
RBD 962 1032 3.12e-28 SMART
RBD 1034 1104 2.44e-21 SMART
Pfam:RGS12_us2 1106 1180 2.4e-37 PFAM
GoLoco 1187 1209 9.74e-9 SMART
Pfam:RGS12_usC 1238 1379 9.2e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114283
SMART Domains Protein: ENSMUSP00000109922
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
RGS 57 174 2.84e-41 SMART
low complexity region 191 207 N/A INTRINSIC
low complexity region 210 222 N/A INTRINSIC
low complexity region 253 270 N/A INTRINSIC
RBD 304 374 3.12e-28 SMART
RBD 376 446 2.44e-21 SMART
GoLoco 529 551 9.74e-9 SMART
low complexity region 601 622 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
low complexity region 697 729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114285
SMART Domains Protein: ENSMUSP00000109924
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
RGS 67 184 2.84e-41 SMART
low complexity region 201 217 N/A INTRINSIC
low complexity region 220 232 N/A INTRINSIC
low complexity region 263 280 N/A INTRINSIC
RBD 314 384 3.12e-28 SMART
RBD 386 456 2.44e-21 SMART
GoLoco 539 561 9.74e-9 SMART
low complexity region 611 632 N/A INTRINSIC
low complexity region 644 660 N/A INTRINSIC
low complexity region 707 739 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150139
SMART Domains Protein: ENSMUSP00000117158
Gene: ENSMUSG00000029101

DomainStartEndE-ValueType
Blast:RBD 2 33 5e-13 BLAST
Pfam:RGS12_us2 35 80 5.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201994
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202168
Predicted Effect probably benign
Transcript: ENSMUST00000202573
SMART Domains Protein: ENSMUSP00000144344
Gene: ENSMUSG00000029102

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000202921
AA Change: Y16H
Meta Mutation Damage Score 0.7440 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: This gene encodes a serine protease enzyme that proteolytically activates hepatocyte growth factor (HGF) and plays a vital role in the regulation of HGF activity in the regeneration and repair of various tissues. The encoded protein is an inactive zymogen that is proteolytically activated to generate a heterodimeric enzyme consisting of a short chain and a long chain linked by a disulfide bridge. Mice lacking the encoded protein display an impairment in mucosal regeneration after injury. [provided by RefSeq, Jul 2015]
PHENOTYPE: Homozygous null mice display impaired intestinal regeneration and increased mortality after intestinal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Hgfac
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00471:Hgfac APN 5 35046526 missense probably damaging 1.00
IGL01999:Hgfac APN 5 35044811 missense probably benign
IGL02133:Hgfac APN 5 35046587 missense probably damaging 1.00
IGL02314:Hgfac APN 5 35041597 start codon destroyed probably benign 0.21
IGL02337:Hgfac APN 5 35042378 missense probably benign 0.00
IGL02405:Hgfac APN 5 35044480 missense probably benign 0.19
IGL02451:Hgfac APN 5 35043814 splice site probably null
IGL02508:Hgfac APN 5 35047220 missense probably damaging 1.00
IGL02584:Hgfac APN 5 35043961 unclassified probably benign
IGL02986:Hgfac APN 5 35043863 missense probably benign 0.00
R0506:Hgfac UTSW 5 35044240 missense probably damaging 1.00
R0664:Hgfac UTSW 5 35048178 missense probably benign 0.34
R1733:Hgfac UTSW 5 35043674 missense probably damaging 1.00
R1775:Hgfac UTSW 5 35042850 unclassified probably benign
R1871:Hgfac UTSW 5 35042913 makesense probably null
R3826:Hgfac UTSW 5 35048162 missense probably damaging 1.00
R4553:Hgfac UTSW 5 35042856 missense probably damaging 0.97
R5888:Hgfac UTSW 5 35045407 missense probably damaging 1.00
R5905:Hgfac UTSW 5 35042362 missense probably benign 0.20
R6056:Hgfac UTSW 5 35041629 nonsense probably null
R6124:Hgfac UTSW 5 35044384 missense probably benign 0.06
R7059:Hgfac UTSW 5 35044429 missense possibly damaging 0.49
R7232:Hgfac UTSW 5 35046914 missense probably damaging 1.00
R7555:Hgfac UTSW 5 35042628 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGTCTGAGCAGCCCATGTC -3'
(R):5'- GAAGACCCTCTGTCCAATCCTTTG -3'

Sequencing Primer
(F):5'- TCTGAGCAGCCCATGTCTGAAC -3'
(R):5'- GCTTATGCAGAAAGAGTATGTATAGC -3'
Posted On2017-06-26