Incidental Mutation 'R6017:Plekhg2'
ID478641
Institutional Source Beutler Lab
Gene Symbol Plekhg2
Ensembl Gene ENSMUSG00000037552
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 2
SynonymsClg
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.413) question?
Stock #R6017 (G1)
Quality Score221.009
Status Validated
Chromosome7
Chromosomal Location28359604-28372599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 28362884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 536 (T536I)
Ref Sequence ENSEMBL: ENSMUSP00000115651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094644] [ENSMUST00000119990] [ENSMUST00000121085] [ENSMUST00000144700]
Predicted Effect probably damaging
Transcript: ENSMUST00000094644
AA Change: T537I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000092228
Gene: ENSMUSG00000037552
AA Change: T537I

DomainStartEndE-ValueType
low complexity region 34 45 N/A INTRINSIC
low complexity region 46 63 N/A INTRINSIC
low complexity region 73 88 N/A INTRINSIC
RhoGEF 103 279 3.98e-49 SMART
PH 305 410 3.01e-8 SMART
low complexity region 463 481 N/A INTRINSIC
low complexity region 582 605 N/A INTRINSIC
low complexity region 842 856 N/A INTRINSIC
low complexity region 1232 1246 N/A INTRINSIC
low complexity region 1268 1292 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119990
AA Change: T536I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112881
Gene: ENSMUSG00000037552
AA Change: T536I

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
low complexity region 1231 1245 N/A INTRINSIC
low complexity region 1267 1291 N/A INTRINSIC
low complexity region 1319 1333 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121085
AA Change: T561I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113449
Gene: ENSMUSG00000037552
AA Change: T561I

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 479 N/A INTRINSIC
low complexity region 606 629 N/A INTRINSIC
low complexity region 866 880 N/A INTRINSIC
low complexity region 1256 1270 N/A INTRINSIC
low complexity region 1292 1316 N/A INTRINSIC
low complexity region 1344 1358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129145
Predicted Effect probably damaging
Transcript: ENSMUST00000144700
AA Change: T536I

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115651
Gene: ENSMUSG00000037552
AA Change: T536I

DomainStartEndE-ValueType
low complexity region 45 62 N/A INTRINSIC
low complexity region 72 87 N/A INTRINSIC
RhoGEF 102 278 3.98e-49 SMART
PH 304 409 3.01e-8 SMART
low complexity region 462 480 N/A INTRINSIC
low complexity region 581 604 N/A INTRINSIC
low complexity region 841 855 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147767
Meta Mutation Damage Score 0.1607 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Plekhg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Plekhg2 APN 7 28360869 nonsense probably null
IGL00933:Plekhg2 APN 7 28360689 missense probably benign 0.01
IGL02037:Plekhg2 APN 7 28368697 missense probably damaging 1.00
IGL02103:Plekhg2 APN 7 28360076 missense probably damaging 1.00
IGL02598:Plekhg2 APN 7 28360475 missense possibly damaging 0.55
IGL02892:Plekhg2 APN 7 28362917 missense probably damaging 1.00
IGL03249:Plekhg2 APN 7 28368002 missense probably damaging 1.00
R0561:Plekhg2 UTSW 7 28370483 missense probably benign
R1134:Plekhg2 UTSW 7 28362001 missense probably damaging 0.99
R1619:Plekhg2 UTSW 7 28368421 missense probably damaging 1.00
R2225:Plekhg2 UTSW 7 28360335 missense probably benign 0.02
R4043:Plekhg2 UTSW 7 28364719 unclassified probably benign
R4117:Plekhg2 UTSW 7 28360888 missense probably benign 0.02
R4296:Plekhg2 UTSW 7 28371166 missense probably damaging 1.00
R4956:Plekhg2 UTSW 7 28368355 missense probably damaging 1.00
R5376:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5378:Plekhg2 UTSW 7 28362669 missense probably damaging 0.99
R5523:Plekhg2 UTSW 7 28370431 missense probably damaging 1.00
R5545:Plekhg2 UTSW 7 28362461 missense probably damaging 1.00
R5667:Plekhg2 UTSW 7 28367639 missense probably damaging 1.00
R5913:Plekhg2 UTSW 7 28364602 missense probably damaging 0.99
R6088:Plekhg2 UTSW 7 28361013 missense probably benign 0.01
R6912:Plekhg2 UTSW 7 28360259 missense probably benign 0.39
R7258:Plekhg2 UTSW 7 28364778 missense probably benign 0.00
R7530:Plekhg2 UTSW 7 28361928 missense probably damaging 1.00
R8054:Plekhg2 UTSW 7 28365316
RF051:Plekhg2 UTSW 7 28362352 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CTGGGGAACTTGGGAATGTC -3'
(R):5'- TGACTTACTTAGTGTGCAAGAGG -3'

Sequencing Primer
(F):5'- GGCTGGCTATAGTGGGCAC -3'
(R):5'- TTACTTAGTGTGCAAGAGGGGAGC -3'
Posted On2017-06-26