Incidental Mutation 'R6017:Cyp1a2'
ID478650
Institutional Source Beutler Lab
Gene Symbol Cyp1a2
Ensembl Gene ENSMUSG00000032310
Gene Namecytochrome P450, family 1, subfamily a, polypeptide 2
SynonymsCP12, aromatic compound inducible, P450-3
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.265) question?
Stock #R6017 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57676937-57683703 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 57681030 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 304 (K304E)
Ref Sequence ENSEMBL: ENSMUSP00000034860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034860]
Predicted Effect probably damaging
Transcript: ENSMUST00000034860
AA Change: K304E

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000034860
Gene: ENSMUSG00000032310
AA Change: K304E

DomainStartEndE-ValueType
Pfam:p450 41 504 1.7e-105 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215792
Meta Mutation Damage Score 0.2147 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The protein encoded by this gene localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown; however, it is able to metabolize some PAHs to carcinogenic intermediates. Other xenobiotic substrates for this enzyme include caffeine, aflatoxin B1, and acetaminophen. The transcript from this gene contains four Alu sequences flanked by direct repeats in the 3' untranslated region. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display resitance to some signs of TCDD induced toxicity but do not display any gross abnormalities in the abscence of treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Cyp1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Cyp1a2 APN 9 57682069 nonsense probably null
IGL01161:Cyp1a2 APN 9 57679893 missense probably damaging 1.00
IGL01583:Cyp1a2 APN 9 57682372 missense probably benign 0.31
IGL01726:Cyp1a2 APN 9 57682202 missense possibly damaging 0.78
IGL01973:Cyp1a2 APN 9 57682395 missense probably damaging 1.00
IGL02995:Cyp1a2 APN 9 57677228 makesense probably null
IGL03349:Cyp1a2 APN 9 57679875 missense possibly damaging 0.82
PIT4515001:Cyp1a2 UTSW 9 57681959 missense probably benign 0.14
R0025:Cyp1a2 UTSW 9 57682061 missense probably damaging 1.00
R0389:Cyp1a2 UTSW 9 57682025 missense probably benign 0.00
R0582:Cyp1a2 UTSW 9 57680246 splice site probably benign
R0589:Cyp1a2 UTSW 9 57679062 missense possibly damaging 0.95
R1239:Cyp1a2 UTSW 9 57681767 missense probably benign 0.02
R1988:Cyp1a2 UTSW 9 57682286 missense possibly damaging 0.90
R2156:Cyp1a2 UTSW 9 57682150 missense probably damaging 1.00
R2173:Cyp1a2 UTSW 9 57677515 missense probably damaging 1.00
R2423:Cyp1a2 UTSW 9 57679949 missense probably damaging 0.99
R3944:Cyp1a2 UTSW 9 57681868 missense probably benign
R5225:Cyp1a2 UTSW 9 57677233 nonsense probably null
R5419:Cyp1a2 UTSW 9 57682511 missense probably benign 0.17
R5471:Cyp1a2 UTSW 9 57679020 missense probably damaging 0.96
R5816:Cyp1a2 UTSW 9 57681053 missense probably benign
R6825:Cyp1a2 UTSW 9 57677260 missense probably benign 0.01
R6931:Cyp1a2 UTSW 9 57682156 missense probably benign 0.02
R7058:Cyp1a2 UTSW 9 57677242 missense probably damaging 0.99
R7079:Cyp1a2 UTSW 9 57681878 missense probably benign
R7081:Cyp1a2 UTSW 9 57678989 missense possibly damaging 0.52
R7400:Cyp1a2 UTSW 9 57681940 missense probably benign 0.37
R7672:Cyp1a2 UTSW 9 57682337 missense probably benign 0.05
RF007:Cyp1a2 UTSW 9 57681970 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGGAGTTGGTGGCACAG -3'
(R):5'- ACTCTATTTAGGGCTGATGCTAGTTC -3'

Sequencing Primer
(F):5'- TGGCACAGCATGAGGTCAC -3'
(R):5'- GGGCTGATGCTAGTTCAAAAATCTG -3'
Posted On2017-06-26