Incidental Mutation 'R6017:Map4'
ID478652
Institutional Source Beutler Lab
Gene Symbol Map4
Ensembl Gene ENSMUSG00000032479
Gene Namemicrotubule-associated protein 4
SynonymsMtap4, MAP 4
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6017 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109931460-110083955 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110034619 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 304 (L304P)
Ref Sequence ENSEMBL: ENSMUSP00000132662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000165876]
Predicted Effect probably benign
Transcript: ENSMUST00000035055
AA Change: L304P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479
AA Change: L304P

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163190
Predicted Effect probably benign
Transcript: ENSMUST00000165876
AA Change: L304P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479
AA Change: L304P

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a major non-neuronal microtubule-associated protein. This protein contains a domain similar to the microtubule-binding domains of neuronal microtubule-associated protein (MAP2) and microtubule-associated protein tau (MAPT/TAU). This protein promotes microtubule assembly, and has been shown to counteract destabilization of interphase microtubule catastrophe promotion. Cyclin B was found to interact with this protein, which targets cell division cycle 2 (CDC2) kinase to microtubules. The phosphorylation of this protein affects microtubule properties and cell cycle progression. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and do not display any overt phenotypic abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Map4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00565:Map4 APN 9 110072604 splice site probably benign
IGL01331:Map4 APN 9 110034801 missense probably benign 0.04
IGL01599:Map4 APN 9 110034768 missense probably benign 0.26
IGL01631:Map4 APN 9 110063133 unclassified probably benign
IGL02208:Map4 APN 9 109978870 start codon destroyed probably null 1.00
IGL02455:Map4 APN 9 109999833 missense probably benign 0.15
IGL02625:Map4 APN 9 110064417 missense probably damaging 1.00
PIT4486001:Map4 UTSW 9 110072614 missense probably damaging 1.00
R0149:Map4 UTSW 9 110067624 missense probably damaging 0.96
R0384:Map4 UTSW 9 110034628 missense probably damaging 0.99
R0392:Map4 UTSW 9 110078045 missense probably damaging 1.00
R0496:Map4 UTSW 9 110039850 intron probably benign
R0526:Map4 UTSW 9 110037278 splice site probably null
R0555:Map4 UTSW 9 109979103 splice site probably benign
R0571:Map4 UTSW 9 110036766 missense probably benign 0.00
R0698:Map4 UTSW 9 110068788 nonsense probably null
R0762:Map4 UTSW 9 110038478 intron probably benign
R0862:Map4 UTSW 9 109978969 missense probably damaging 1.00
R0864:Map4 UTSW 9 109978969 missense probably damaging 1.00
R1168:Map4 UTSW 9 110034964 missense probably benign 0.00
R1238:Map4 UTSW 9 110068580 missense probably benign 0.00
R1735:Map4 UTSW 9 110034955 missense probably benign 0.00
R1869:Map4 UTSW 9 110034964 missense probably benign 0.00
R1869:Map4 UTSW 9 110068928 missense possibly damaging 0.95
R2196:Map4 UTSW 9 110071048 missense probably damaging 1.00
R2264:Map4 UTSW 9 110081457 missense probably damaging 1.00
R2507:Map4 UTSW 9 110037483 intron probably benign
R2512:Map4 UTSW 9 110034702 missense possibly damaging 0.48
R3087:Map4 UTSW 9 110053189 missense possibly damaging 0.84
R3154:Map4 UTSW 9 109999792 missense probably benign 0.19
R3498:Map4 UTSW 9 110035212 missense probably benign 0.03
R3547:Map4 UTSW 9 110052198 missense possibly damaging 0.61
R3751:Map4 UTSW 9 110038674 intron probably benign
R4036:Map4 UTSW 9 110032215 missense possibly damaging 0.47
R4423:Map4 UTSW 9 110067594 missense probably damaging 1.00
R4505:Map4 UTSW 9 110032185 missense probably benign 0.01
R4561:Map4 UTSW 9 110052371 missense possibly damaging 0.91
R4577:Map4 UTSW 9 110081421 missense possibly damaging 0.48
R4601:Map4 UTSW 9 110052819 missense possibly damaging 0.75
R4795:Map4 UTSW 9 110035263 missense probably benign 0.00
R4801:Map4 UTSW 9 110035257 missense probably benign 0.15
R4802:Map4 UTSW 9 110035257 missense probably benign 0.15
R4999:Map4 UTSW 9 110038377 intron probably benign
R5020:Map4 UTSW 9 110068800 missense probably benign 0.02
R5021:Map4 UTSW 9 110038089 nonsense probably null
R5049:Map4 UTSW 9 110079814 nonsense probably null
R5451:Map4 UTSW 9 110037783 intron probably benign
R5452:Map4 UTSW 9 110037783 intron probably benign
R5453:Map4 UTSW 9 110037783 intron probably benign
R5492:Map4 UTSW 9 110052382 missense possibly damaging 0.68
R5532:Map4 UTSW 9 110034678 missense probably benign 0.24
R5602:Map4 UTSW 9 110052700 missense possibly damaging 0.84
R5628:Map4 UTSW 9 110081847 missense probably benign 0.04
R5896:Map4 UTSW 9 110072634 missense possibly damaging 0.91
R6084:Map4 UTSW 9 110064292 missense probably damaging 1.00
R6294:Map4 UTSW 9 110002746 missense possibly damaging 0.82
R6397:Map4 UTSW 9 110027716 missense possibly damaging 0.78
R6773:Map4 UTSW 9 110034925 missense probably benign 0.00
R6997:Map4 UTSW 9 110052914 missense probably benign 0.35
R7141:Map4 UTSW 9 109978870 start codon destroyed probably null 1.00
R7187:Map4 UTSW 9 110053133 missense probably benign 0.03
R7320:Map4 UTSW 9 110081517 missense probably benign 0.24
R7479:Map4 UTSW 9 110068824 missense possibly damaging 0.94
R7487:Map4 UTSW 9 110027715 missense probably damaging 1.00
R7690:Map4 UTSW 9 109999793 missense probably damaging 0.99
R7780:Map4 UTSW 9 110034652 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACTGATGTGGTGCACTCTC -3'
(R):5'- AGTGAAACCATGCCCTTGG -3'

Sequencing Primer
(F):5'- GGTGCACTCTCCATCCACAG -3'
(R):5'- TAAGTAACACATCCTCAGGTGGTGC -3'
Posted On2017-06-26