Incidental Mutation 'R6017:Cdc42ep4'
ID478657
Institutional Source Beutler Lab
Gene Symbol Cdc42ep4
Ensembl Gene ENSMUSG00000041598
Gene NameCDC42 effector protein (Rho GTPase binding) 4
SynonymsCEP4, 1500041M20Rik, Borg4
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.075) question?
Stock #R6017 (G1)
Quality Score218.009
Status Validated
Chromosome11
Chromosomal Location113726850-113751881 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113729366 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 66 (D66E)
Ref Sequence ENSEMBL: ENSMUSP00000120316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053536] [ENSMUST00000106616] [ENSMUST00000131488] [ENSMUST00000153453]
Predicted Effect probably benign
Transcript: ENSMUST00000053536
AA Change: D66E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000060227
Gene: ENSMUSG00000041598
AA Change: D66E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1e-13 PFAM
Pfam:BORG_CEP 110 224 1e-35 PFAM
low complexity region 280 308 N/A INTRINSIC
low complexity region 340 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106616
AA Change: D66E

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000102227
Gene: ENSMUSG00000041598
AA Change: D66E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 2.6e-14 PFAM
Pfam:BORG_CEP 110 219 1.6e-24 PFAM
low complexity region 280 308 N/A INTRINSIC
low complexity region 340 346 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131488
AA Change: D66E

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000114599
Gene: ENSMUSG00000041598
AA Change: D66E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1.1e-13 PFAM
Pfam:BORG_CEP 110 194 7.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153453
AA Change: D66E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120316
Gene: ENSMUSG00000041598
AA Change: D66E

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:PBD 26 83 1.6e-14 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the CDC42-binding protein family. Members of this family interact with Rho family GTPases and regulate the organization of the actin cytoskeleton. This protein has been shown to bind both CDC42 and TC10 GTPases in a GTP-dependent manner. When overexpressed in fibroblasts, this protein was able to induce pseudopodia formation, which suggested a role in inducing actin filament assembly and cell shape control. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired glutamate clearance and motor learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Cdc42ep4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Cdc42ep4 APN 11 113729502 missense probably damaging 1.00
IGL01715:Cdc42ep4 APN 11 113729442 missense probably damaging 1.00
IGL01960:Cdc42ep4 APN 11 113729004 missense probably benign
IGL02118:Cdc42ep4 APN 11 113729116 missense probably benign 0.02
IGL02983:Cdc42ep4 APN 11 113729169 missense probably benign 0.13
R0621:Cdc42ep4 UTSW 11 113728696 missense probably damaging 1.00
R1590:Cdc42ep4 UTSW 11 113728566 missense possibly damaging 0.82
R1663:Cdc42ep4 UTSW 11 113729451 missense probably damaging 1.00
R1791:Cdc42ep4 UTSW 11 113729337 missense probably damaging 1.00
R2360:Cdc42ep4 UTSW 11 113728702 missense probably damaging 1.00
R6053:Cdc42ep4 UTSW 11 113728986 missense probably damaging 1.00
R6967:Cdc42ep4 UTSW 11 113729172 missense possibly damaging 0.79
R7066:Cdc42ep4 UTSW 11 113729218 missense probably damaging 1.00
R7082:Cdc42ep4 UTSW 11 113729118 missense probably benign
R7556:Cdc42ep4 UTSW 11 113728540 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCATTGAGCTGAGGCAGG -3'
(R):5'- ATACCTGCCTGTTGCCTTGG -3'

Sequencing Primer
(F):5'- CAGGGACATGGCATTCTTGAC -3'
(R):5'- GCCCATTCTCAAACAGCTGGTG -3'
Posted On2017-06-26