Incidental Mutation 'R6017:Cntnap5c'
ID478676
Institutional Source Beutler Lab
Gene Symbol Cntnap5c
Ensembl Gene ENSMUSG00000038048
Gene Namecontactin associated protein-like 5C
Synonyms
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6017 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57769570-58410355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58104698 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 526 (I526F)
Ref Sequence ENSEMBL: ENSMUSP00000075416 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076038]
Predicted Effect probably benign
Transcript: ENSMUST00000076038
AA Change: I526F

PolyPhen 2 Score 0.414 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000075416
Gene: ENSMUSG00000038048
AA Change: I526F

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
FA58C 29 174 1.26e-10 SMART
LamG 201 338 1.57e-29 SMART
LamG 387 521 3e-26 SMART
EGF 549 583 1.88e-1 SMART
Blast:FBG 586 769 8e-83 BLAST
LamG 811 938 4.37e-28 SMART
EGF 959 995 6.55e-1 SMART
LamG 1036 1172 2.08e-11 SMART
transmembrane domain 1240 1262 N/A INTRINSIC
Meta Mutation Damage Score 0.1541 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Ddx11 A G 17: 66,130,017 D102G probably benign Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Cntnap5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Cntnap5c APN 17 58162277 missense probably benign 0.00
IGL00543:Cntnap5c APN 17 58294350 missense probably benign
IGL00679:Cntnap5c APN 17 58055678 missense probably damaging 0.98
IGL00942:Cntnap5c APN 17 57769598 missense probably benign 0.03
IGL01352:Cntnap5c APN 17 58293901 missense probably benign 0.00
IGL01822:Cntnap5c APN 17 58055705 missense probably damaging 0.99
IGL01864:Cntnap5c APN 17 58410242 missense probably benign
IGL01922:Cntnap5c APN 17 58330119 missense possibly damaging 0.95
IGL02111:Cntnap5c APN 17 58102108 missense probably damaging 1.00
IGL02112:Cntnap5c APN 17 58313858 missense probably benign 0.00
IGL02259:Cntnap5c APN 17 58034862 missense probably damaging 0.98
IGL02270:Cntnap5c APN 17 58034853 missense probably benign 0.08
IGL02312:Cntnap5c APN 17 58138699 missense probably benign 0.09
IGL02456:Cntnap5c APN 17 58407744 splice site probably benign
IGL02755:Cntnap5c APN 17 58364194 missense probably benign 0.02
IGL02955:Cntnap5c APN 17 57892102 splice site probably benign
IGL03001:Cntnap5c APN 17 58055639 missense probably damaging 1.00
IGL03012:Cntnap5c APN 17 58359234 missense probably benign 0.01
IGL03243:Cntnap5c APN 17 58102176 missense probably benign 0.01
IGL03375:Cntnap5c APN 17 58162205 missense possibly damaging 0.94
IGL02802:Cntnap5c UTSW 17 58305684 missense probably benign 0.04
LCD18:Cntnap5c UTSW 17 58162160 intron probably benign
R0003:Cntnap5c UTSW 17 58199017 missense probably benign
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0041:Cntnap5c UTSW 17 57876469 missense probably benign 0.00
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0046:Cntnap5c UTSW 17 58359300 missense probably benign
R0179:Cntnap5c UTSW 17 57769625 missense probably benign 0.19
R0244:Cntnap5c UTSW 17 58102168 missense probably damaging 1.00
R0445:Cntnap5c UTSW 17 58104743 missense probably benign 0.01
R0626:Cntnap5c UTSW 17 58042427 missense probably benign 0.29
R0675:Cntnap5c UTSW 17 58034995 missense probably damaging 1.00
R0681:Cntnap5c UTSW 17 58305555 missense possibly damaging 0.91
R0699:Cntnap5c UTSW 17 58042498 missense probably damaging 1.00
R0927:Cntnap5c UTSW 17 58042558 missense possibly damaging 0.78
R1081:Cntnap5c UTSW 17 58305525 missense possibly damaging 0.90
R1132:Cntnap5c UTSW 17 58294356 missense probably damaging 1.00
R1175:Cntnap5c UTSW 17 58364246 missense possibly damaging 0.51
R1640:Cntnap5c UTSW 17 58395294 missense probably benign 0.01
R1664:Cntnap5c UTSW 17 58293990 missense probably benign 0.00
R1758:Cntnap5c UTSW 17 58042550 missense probably damaging 1.00
R1785:Cntnap5c UTSW 17 58162291 missense probably benign 0.00
R1789:Cntnap5c UTSW 17 58013921 missense probably damaging 1.00
R1968:Cntnap5c UTSW 17 58359296 missense probably damaging 1.00
R2041:Cntnap5c UTSW 17 58104770 critical splice donor site probably null
R2041:Cntnap5c UTSW 17 58198989 missense probably benign 0.02
R2073:Cntnap5c UTSW 17 58305552 missense possibly damaging 0.58
R2093:Cntnap5c UTSW 17 58199000 missense probably benign 0.00
R2134:Cntnap5c UTSW 17 58407722 missense probably damaging 1.00
R2153:Cntnap5c UTSW 17 58055671 missense possibly damaging 0.90
R2176:Cntnap5c UTSW 17 58013946 missense probably benign 0.04
R2256:Cntnap5c UTSW 17 58330315 missense probably benign 0.00
R2847:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2848:Cntnap5c UTSW 17 57876392 missense probably damaging 0.99
R2850:Cntnap5c UTSW 17 58410348 utr 3 prime probably benign
R3008:Cntnap5c UTSW 17 58359209 missense probably damaging 1.00
R3714:Cntnap5c UTSW 17 57892067 nonsense probably null
R3720:Cntnap5c UTSW 17 58330202 missense probably benign
R3755:Cntnap5c UTSW 17 58104599 missense possibly damaging 0.82
R4001:Cntnap5c UTSW 17 58407740 critical splice donor site probably null
R4619:Cntnap5c UTSW 17 58410268 missense probably benign
R5146:Cntnap5c UTSW 17 58013847 missense probably damaging 0.96
R5309:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5312:Cntnap5c UTSW 17 58359254 missense probably benign 0.05
R5722:Cntnap5c UTSW 17 58313857 missense probably benign 0.01
R5974:Cntnap5c UTSW 17 57876485 missense probably benign 0.00
R6059:Cntnap5c UTSW 17 58313712 missense probably damaging 0.99
R6152:Cntnap5c UTSW 17 58286886 missense possibly damaging 0.65
R6182:Cntnap5c UTSW 17 57876395 missense probably benign 0.00
R6298:Cntnap5c UTSW 17 58104752 missense probably damaging 1.00
R6301:Cntnap5c UTSW 17 57892037 missense probably benign 0.01
R6514:Cntnap5c UTSW 17 58330170 missense probably damaging 0.96
R6583:Cntnap5c UTSW 17 58330277 missense probably damaging 1.00
R6688:Cntnap5c UTSW 17 58293904 missense possibly damaging 0.71
R6781:Cntnap5c UTSW 17 58138653 nonsense probably null
R6866:Cntnap5c UTSW 17 58092294 missense probably benign
R6906:Cntnap5c UTSW 17 58395307 missense probably benign 0.18
R6911:Cntnap5c UTSW 17 57892014 missense probably damaging 1.00
R6919:Cntnap5c UTSW 17 58293953 missense probably benign 0.02
R6923:Cntnap5c UTSW 17 58092350 missense possibly damaging 0.96
R6925:Cntnap5c UTSW 17 58395266 missense probably benign 0.39
R6982:Cntnap5c UTSW 17 58092252 missense possibly damaging 0.77
R7144:Cntnap5c UTSW 17 58286888 missense probably benign
R7422:Cntnap5c UTSW 17 58410231 nonsense probably null
R7797:Cntnap5c UTSW 17 58359275 missense probably benign 0.11
R7830:Cntnap5c UTSW 17 58162250 missense probably damaging 1.00
RF010:Cntnap5c UTSW 17 58286795 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCCAAATAACTAGAGCTTACTG -3'
(R):5'- AACCGTTTTCTCTGGACTTGAAATCC -3'

Sequencing Primer
(F):5'- CCAAATAACTAGAGCTTACTGTCTTC -3'
(R):5'- ATGTCTAGTGTGGTAAATGTCTACAG -3'
Posted On2017-06-26