Incidental Mutation 'R6017:Ddx11'
ID478677
Institutional Source Beutler Lab
Gene Symbol Ddx11
Ensembl Gene ENSMUSG00000035842
Gene NameDEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11
SynonymsCHL1, 4732462I11Rik, CHLR1, essa15a, KRG2
MMRRC Submission 044191-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6017 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location66123520-66152174 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66130017 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 102 (D102G)
Ref Sequence ENSEMBL: ENSMUSP00000153436 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000163605] [ENSMUST00000224497] [ENSMUST00000224903] [ENSMUST00000225956]
Predicted Effect probably benign
Transcript: ENSMUST00000163605
AA Change: D102G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130440
Gene: ENSMUSG00000035842
AA Change: D102G

DomainStartEndE-ValueType
DEXDc 11 408 1.14e-153 SMART
Blast:DEXDc2 430 479 6e-14 BLAST
HELICc 682 839 1.4e-66 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223600
Predicted Effect probably benign
Transcript: ENSMUST00000224497
AA Change: D102G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000224903
AA Change: D102G

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225687
Predicted Effect probably benign
Transcript: ENSMUST00000225956
AA Change: D102G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.0%
  • 20x: 90.5%
Validation Efficiency 97% (62/64)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit lethality before E11.5 with growth retardation, failure of chorioallantoic fusion, poor placental labyrinth development, and embryonic cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik T A 7: 118,809,921 V635D probably damaging Het
Adgb T C 10: 10,450,036 I56M probably damaging Het
Adgrv1 A T 13: 81,397,423 L5581* probably null Het
Arpc2 C A 1: 74,262,486 H193N probably benign Het
B3galt5 A G 16: 96,315,184 T6A probably benign Het
Bod1l A T 5: 41,818,760 V1737E probably benign Het
Cacfd1 T G 2: 27,013,428 probably benign Het
Cdc42ep4 A T 11: 113,729,366 D66E probably benign Het
Cldn1 G T 16: 26,363,219 T80N probably damaging Het
Cmtm1 C A 8: 104,310,951 probably benign Het
Cntnap5c A T 17: 58,104,698 I526F probably benign Het
Copb1 T C 7: 114,236,797 K450E probably benign Het
Crebrf A C 17: 26,757,849 I416L probably benign Het
Csmd3 C A 15: 48,314,012 V377F possibly damaging Het
Cyp1a2 T C 9: 57,681,030 K304E probably damaging Het
Cyp2d26 A G 15: 82,790,573 S403P possibly damaging Het
Cyp4a12a T A 4: 115,326,279 C198* probably null Het
Dpys T A 15: 39,846,718 Q105L probably null Het
Dsn1 C A 2: 156,996,242 R334L probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Epha8 G T 4: 136,931,743 H867N probably damaging Het
Ephb3 T C 16: 21,222,031 L643P probably damaging Het
Fbxo44 G T 4: 148,158,553 H83Q probably benign Het
Gm13102 T C 4: 144,109,237 Y477H possibly damaging Het
Gm7347 T C 5: 26,057,278 T82A probably benign Het
Gss C A 2: 155,587,465 A36S probably benign Het
Hepacam A G 9: 37,380,760 D128G probably benign Het
Hepacam2 C A 6: 3,483,332 V226F probably damaging Het
Hgfac T C 5: 35,044,395 Y291H probably damaging Het
Ip6k2 G A 9: 108,797,267 R88H probably benign Het
Irx5 T A 8: 92,358,250 Y23N probably damaging Het
Kcnf1 T C 12: 17,175,081 M380V probably damaging Het
Kcnj1 A T 9: 32,394,104 probably benign Het
Kcnk12 T C 17: 87,746,736 E166G probably damaging Het
Kctd16 T C 18: 40,258,943 C195R probably damaging Het
Kif28 T A 1: 179,699,453 I718F probably benign Het
Lce1e T A 3: 92,707,933 K36* probably null Het
Map4 T C 9: 110,034,619 L304P probably benign Het
Mettl17 C T 14: 51,891,617 probably benign Het
Mpp4 T C 1: 59,121,359 D595G probably damaging Het
Myo18a A G 11: 77,841,523 K1282E probably damaging Het
Nf2 A T 11: 4,816,137 V131D possibly damaging Het
Olfr147 A T 9: 38,403,620 M249L probably benign Het
Olfr855 T C 9: 19,585,434 V299A probably benign Het
Oxsr1 A G 9: 119,264,777 L270S probably benign Het
Plekhg2 G A 7: 28,362,884 T536I probably damaging Het
Ppp1r9a T A 6: 4,906,363 V306D probably benign Het
Ptk6 C T 2: 181,195,812 C438Y probably benign Het
Scfd1 T C 12: 51,445,678 V590A probably damaging Het
Serpina1b A G 12: 103,729,272 S337P probably damaging Het
Skor2 T A 18: 76,858,927 C115S unknown Het
Slc2a7 T C 4: 150,165,172 S407P probably damaging Het
Slc8a1 A G 17: 81,648,254 S452P probably damaging Het
Spata31d1c A G 13: 65,035,079 D145G possibly damaging Het
Spata6 C A 4: 111,774,827 T145K probably damaging Het
Stab1 C T 14: 31,141,544 R2087H probably benign Het
Stk24 C T 14: 121,302,245 V180M probably benign Het
Trrap A G 5: 144,844,241 T3271A probably damaging Het
Tyro3 T A 2: 119,816,666 W755R probably damaging Het
Ush2a T C 1: 188,957,514 probably null Het
Uts2b T C 16: 27,361,043 probably null Het
Vmn2r105 T A 17: 20,208,627 H729L probably damaging Het
Wdfy3 T C 5: 101,851,359 I3068V probably benign Het
Zfp457 G A 13: 67,293,699 H175Y probably damaging Het
Zfp758 A G 17: 22,373,731 D40G probably damaging Het
Other mutations in Ddx11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Ddx11 APN 17 66134137 missense probably damaging 1.00
IGL01577:Ddx11 APN 17 66139403 missense possibly damaging 0.95
IGL02558:Ddx11 APN 17 66148672 missense probably damaging 0.99
IGL02801:Ddx11 APN 17 66148033 missense probably benign 0.03
R1550:Ddx11 UTSW 17 66138220 missense probably benign 0.16
R1587:Ddx11 UTSW 17 66149256 missense probably damaging 1.00
R1601:Ddx11 UTSW 17 66150385 missense probably damaging 1.00
R1625:Ddx11 UTSW 17 66150697 missense probably benign 0.45
R1714:Ddx11 UTSW 17 66148759 missense probably damaging 1.00
R1867:Ddx11 UTSW 17 66135939 intron probably null
R1959:Ddx11 UTSW 17 66130728 missense probably benign 0.27
R1980:Ddx11 UTSW 17 66148739 missense probably damaging 0.97
R2392:Ddx11 UTSW 17 66149973 missense probably damaging 1.00
R3118:Ddx11 UTSW 17 66149277 missense probably damaging 1.00
R3425:Ddx11 UTSW 17 66139439 missense possibly damaging 0.62
R3983:Ddx11 UTSW 17 66134130 missense probably damaging 1.00
R4571:Ddx11 UTSW 17 66130773 missense probably benign 0.20
R4576:Ddx11 UTSW 17 66150726 missense probably damaging 1.00
R4847:Ddx11 UTSW 17 66130801 missense probably damaging 1.00
R5010:Ddx11 UTSW 17 66147722 missense possibly damaging 0.60
R5414:Ddx11 UTSW 17 66148768 missense probably benign 0.40
R5610:Ddx11 UTSW 17 66150026 missense probably damaging 1.00
R5822:Ddx11 UTSW 17 66129981 missense probably benign 0.00
R5972:Ddx11 UTSW 17 66148090 missense probably benign 0.05
R6267:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R6296:Ddx11 UTSW 17 66150729 critical splice donor site probably null
R7205:Ddx11 UTSW 17 66130771 missense probably benign 0.25
R7531:Ddx11 UTSW 17 66138219 missense probably benign 0.00
R7544:Ddx11 UTSW 17 66126285 missense probably damaging 0.98
R7593:Ddx11 UTSW 17 66126198 missense possibly damaging 0.48
R7778:Ddx11 UTSW 17 66130548 critical splice donor site probably null
R7824:Ddx11 UTSW 17 66130548 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCAGGGAAAGTCCTTAAG -3'
(R):5'- TCTCATTGCAAGTTCACCCAAG -3'

Sequencing Primer
(F):5'- CAGGGAAAGTCCTTAAGTCTGATTTG -3'
(R):5'- AAGTTCACCCAAGGGCTG -3'
Posted On2017-06-26