Incidental Mutation 'R6018:Lamc3'
ID478693
Institutional Source Beutler Lab
Gene Symbol Lamc3
Ensembl Gene ENSMUSG00000026840
Gene Namelaminin gamma 3
Synonyms
MMRRC Submission 044192-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6018 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location31887291-31946539 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 31905712 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Tryptophan at position 370 (G370W)
Ref Sequence ENSEMBL: ENSMUSP00000118745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028187] [ENSMUST00000138325]
Predicted Effect probably damaging
Transcript: ENSMUST00000028187
AA Change: G370W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028187
Gene: ENSMUSG00000026840
AA Change: G370W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1234 1247 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
coiled coil region 1444 1467 N/A INTRINSIC
coiled coil region 1528 1575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138325
AA Change: G370W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118745
Gene: ENSMUSG00000026840
AA Change: G370W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
LamNT 38 278 4.32e-115 SMART
EGF_Lam 280 333 4.19e-8 SMART
EGF_Lam 336 389 4.81e-8 SMART
EGF_Lam 392 436 2.52e-11 SMART
EGF_Lam 439 486 1.16e-10 SMART
low complexity region 538 549 N/A INTRINSIC
low complexity region 591 603 N/A INTRINSIC
EGF_like 649 716 3.69e0 SMART
EGF_Lam 719 764 3.1e-11 SMART
EGF_Lam 767 819 3.43e-4 SMART
EGF_Lam 822 875 2.16e-10 SMART
EGF_Lam 878 925 6.29e-12 SMART
EGF_Lam 928 973 1.62e-14 SMART
EGF_Lam 976 1021 1.02e-6 SMART
low complexity region 1032 1046 N/A INTRINSIC
coiled coil region 1119 1150 N/A INTRINSIC
low complexity region 1245 1258 N/A INTRINSIC
low complexity region 1408 1418 N/A INTRINSIC
coiled coil region 1455 1478 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. Several isoforms of each chain have been described. Different alpha, beta and gamma chain isomers combine to give rise to different heterotrimeric laminin isoforms which are designated by Arabic numerals in the order of their discovery, i.e. alpha1beta1gamma1 heterotrimer is laminin 1. The biological functions of the different chains and trimer molecules are largely unknown, but some of the chains have been shown to differ with respect to their tissue distribution, presumably reflecting diverse functions in vivo. This gene encodes the gamma chain isoform laminin, gamma 3. The gamma 3 chain is most similar to the gamma 1 chain, and contains all the 6 domains expected of the gamma chain. It is a component of laminin 12. The gamma 3 chain is broadly expressed in skin, heart, lung, and the reproductive tracts. In skin, it is seen within the basement membrane of the dermal-epidermal junction at points of nerve penetration. Gamma 3 is also a prominent element of the apical surface of ciliated epithelial cells of lung, oviduct, epididymis, ductus deferens, and seminiferous tubules. The distribution of gamma 3-containing laminins along ciliated epithelial surfaces suggests that the apical laminins are important in the morphogenesis and structural stability of the ciliated processes of these cells. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a reporter allele exhibit abnormal amacrine cell morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,799 Y155N probably damaging Het
1700019A02Rik C T 1: 53,163,246 probably null Het
2310022B05Rik A G 8: 124,639,114 F297L probably benign Het
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Agbl3 A G 6: 34,799,255 N227S probably damaging Het
Ak6 C T 13: 100,665,951 Q151* probably null Het
Ano4 A G 10: 89,029,266 L297P probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Ap5s1 G A 2: 131,212,995 W212* probably null Het
Arl9 A G 5: 77,007,406 Q113R probably damaging Het
Atg2b T C 12: 105,661,171 H519R probably damaging Het
Atp1a2 A G 1: 172,298,012 probably benign Het
Atp2b1 G A 10: 99,010,760 A808T probably damaging Het
Bckdhb C A 9: 84,069,184 T342K probably benign Het
Bdp1 T C 13: 100,038,224 H1996R probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Ccdc180 A G 4: 45,926,235 I1148M probably damaging Het
Csf3r T A 4: 126,043,621 M766K probably benign Het
Ctnnd1 T A 2: 84,650,468 probably benign Het
Cyp2c39 A T 19: 39,510,992 N41I probably damaging Het
D2hgdh G T 1: 93,826,460 V52L probably benign Het
Dppa4 T A 16: 48,289,127 Y77* probably null Het
Eif4enif1 T C 11: 3,242,481 S770P probably damaging Het
Fbxl16 A T 17: 25,817,735 D230V probably damaging Het
Gm4847 G A 1: 166,643,448 A11V probably damaging Het
Gm9978 C T 10: 78,487,081 noncoding transcript Het
Gpatch8 A G 11: 102,480,915 L599P unknown Het
Hdac4 A G 1: 91,958,398 L254P probably damaging Het
Heatr1 A G 13: 12,404,947 I384V probably benign Het
Heatr1 A T 13: 12,406,058 Q410L probably benign Het
Hmcn2 A G 2: 31,370,792 I1065V probably benign Het
Igkv6-14 A G 6: 70,435,040 S87P probably damaging Het
Il2rb G T 15: 78,482,066 Q344K possibly damaging Het
Ipo4 A G 14: 55,626,152 probably null Het
Ipo9 A G 1: 135,390,536 probably null Het
Khdrbs1 T C 4: 129,720,094 T374A probably benign Het
Lipn T A 19: 34,076,935 L191Q probably damaging Het
Lpl T C 8: 68,901,288 V427A probably benign Het
Magi3 T C 3: 104,105,812 S120G probably damaging Het
Mgl2 T C 11: 70,137,111 *382Q probably null Het
Nab2 G A 10: 127,664,924 Q100* probably null Het
Nfat5 T A 8: 107,355,651 probably null Het
Nqo1 T C 8: 107,388,868 H259R probably damaging Het
Nrd1 T A 4: 109,013,747 D190E probably benign Het
Olfr1030 T A 2: 85,984,804 probably benign Het
Osmr G A 15: 6,815,795 P830L probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pde11a T A 2: 76,017,850 M878L probably benign Het
Pik3ap1 T C 19: 41,385,016 probably benign Het
Pla2g3 T C 11: 3,491,916 L360P probably damaging Het
Plxnc1 A G 10: 94,943,848 V244A probably benign Het
Pramef25 C T 4: 143,950,899 A37T possibly damaging Het
Ptpra T C 2: 130,503,502 V8A probably benign Het
Rbbp5 T C 1: 132,494,340 V199A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A G 1: 4,352,836 V7A possibly damaging Het
Sdk2 T C 11: 113,830,063 T1347A probably benign Het
Sgo2a T A 1: 58,016,959 H767Q probably benign Het
Sis G A 3: 72,913,192 P1413L possibly damaging Het
Slc22a5 G T 11: 53,876,020 A214E probably damaging Het
Snx13 G T 12: 35,047,319 probably benign Het
Sun5 T A 2: 153,858,443 I295F probably damaging Het
Themis3 C T 17: 66,593,209 A55T probably damaging Het
Tmem255b T C 8: 13,455,138 Y148H probably benign Het
Tmem74b A G 2: 151,706,719 E122G probably damaging Het
Top3b T C 16: 16,892,892 V862A probably damaging Het
Trim35 A T 14: 66,308,750 D322V probably damaging Het
Trpm2 A G 10: 77,917,713 F1319S probably benign Het
Ttn T A 2: 76,954,676 R756S probably benign Het
Vmn2r108 A T 17: 20,463,006 N645K possibly damaging Het
Vmn2r73 A G 7: 85,872,667 S155P possibly damaging Het
Vstm4 G A 14: 32,863,670 A65T probably benign Het
Other mutations in Lamc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Lamc3 APN 2 31900581 missense probably damaging 0.99
IGL00823:Lamc3 APN 2 31918521 missense probably damaging 1.00
IGL01020:Lamc3 APN 2 31914656 missense probably benign 0.07
IGL01086:Lamc3 APN 2 31898476 missense probably damaging 1.00
IGL01618:Lamc3 APN 2 31912107 missense probably damaging 0.99
IGL01655:Lamc3 APN 2 31898278 missense probably damaging 1.00
IGL02093:Lamc3 APN 2 31887655 missense probably damaging 1.00
IGL02309:Lamc3 APN 2 31914604 splice site probably benign
IGL02340:Lamc3 APN 2 31918457 missense probably damaging 1.00
IGL02410:Lamc3 APN 2 31905965 missense probably damaging 0.99
IGL02548:Lamc3 APN 2 31920662 missense probably benign 0.00
IGL02679:Lamc3 APN 2 31945398 missense probably benign 0.01
IGL02751:Lamc3 APN 2 31920704 missense probably benign 0.07
IGL02820:Lamc3 APN 2 31923022 missense probably damaging 1.00
IGL02926:Lamc3 APN 2 31935725 splice site probably benign
IGL02926:Lamc3 APN 2 31935726 splice site probably benign
IGL03090:Lamc3 APN 2 31908698 splice site probably benign
IGL03258:Lamc3 APN 2 31887683 missense probably damaging 1.00
R0005:Lamc3 UTSW 2 31922428 missense probably benign 0.07
R0137:Lamc3 UTSW 2 31908616 missense probably damaging 1.00
R0179:Lamc3 UTSW 2 31915084 splice site probably benign
R0244:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R0512:Lamc3 UTSW 2 31937968 missense probably damaging 1.00
R1052:Lamc3 UTSW 2 31928802 missense probably benign 0.03
R1142:Lamc3 UTSW 2 31940721 missense probably damaging 1.00
R1366:Lamc3 UTSW 2 31928847 missense probably damaging 1.00
R1463:Lamc3 UTSW 2 31887411 missense probably benign
R1515:Lamc3 UTSW 2 31940751 missense probably damaging 1.00
R1642:Lamc3 UTSW 2 31915996 missense probably damaging 1.00
R1692:Lamc3 UTSW 2 31921781 missense probably null 0.01
R1707:Lamc3 UTSW 2 31912129 critical splice donor site probably null
R1714:Lamc3 UTSW 2 31940757 missense probably benign 0.02
R1838:Lamc3 UTSW 2 31925582 missense possibly damaging 0.89
R2940:Lamc3 UTSW 2 31940702 missense probably benign 0.02
R3177:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3277:Lamc3 UTSW 2 31908625 missense probably damaging 1.00
R3846:Lamc3 UTSW 2 31924592 missense probably benign 0.01
R4065:Lamc3 UTSW 2 31945258 missense probably benign 0.00
R4089:Lamc3 UTSW 2 31920508 nonsense probably null
R4373:Lamc3 UTSW 2 31898232 missense probably damaging 1.00
R4394:Lamc3 UTSW 2 31931952 missense probably benign
R4395:Lamc3 UTSW 2 31931952 missense probably benign
R4397:Lamc3 UTSW 2 31931952 missense probably benign
R4746:Lamc3 UTSW 2 31905614 missense possibly damaging 0.77
R4948:Lamc3 UTSW 2 31940736 missense probably benign 0.02
R4960:Lamc3 UTSW 2 31915954 missense probably benign 0.00
R5025:Lamc3 UTSW 2 31908669 missense probably benign 0.13
R5062:Lamc3 UTSW 2 31905667 missense possibly damaging 0.60
R5170:Lamc3 UTSW 2 31887344 start codon destroyed probably benign 0.03
R5286:Lamc3 UTSW 2 31918596 missense probably damaging 1.00
R5457:Lamc3 UTSW 2 31931985 missense probably benign
R5655:Lamc3 UTSW 2 31925717 missense probably benign 0.01
R5928:Lamc3 UTSW 2 31921709 missense probably benign 0.00
R6479:Lamc3 UTSW 2 31887401 missense probably benign
R6601:Lamc3 UTSW 2 31920532 missense possibly damaging 0.94
R6920:Lamc3 UTSW 2 31908689 missense probably damaging 1.00
R6924:Lamc3 UTSW 2 31938069 missense probably benign
R7114:Lamc3 UTSW 2 31930645 missense probably damaging 0.99
R7305:Lamc3 UTSW 2 31930702 missense probably benign 0.39
R7559:Lamc3 UTSW 2 31922368 missense probably benign 0.00
R7787:Lamc3 UTSW 2 31900539 missense probably damaging 0.99
R7819:Lamc3 UTSW 2 31921763 missense probably benign
X0010:Lamc3 UTSW 2 31938012 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCTTCAGAGAGCATAGTC -3'
(R):5'- TTGTCACACTGGAGACTCAGAG -3'

Sequencing Primer
(F):5'- GCTTCAGAGAGCATAGTCTCTCAG -3'
(R):5'- CACTGGAGACTCAGAGAGCCTG -3'
Posted On2017-06-26