Incidental Mutation 'R6018:Sis'
ID478702
Institutional Source Beutler Lab
Gene Symbol Sis
Ensembl Gene ENSMUSG00000027790
Gene Namesucrase isomaltase (alpha-glucosidase)
SynonymsSi-s, sucrase-isomaltase
MMRRC Submission 044192-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6018 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location72888557-72967863 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72913192 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 1413 (P1413L)
Ref Sequence ENSEMBL: ENSMUSP00000129116 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094190] [ENSMUST00000167334]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094190
AA Change: P1413L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000091742
Gene: ENSMUSG00000027790
AA Change: P1413L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000167334
AA Change: P1413L

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000129116
Gene: ENSMUSG00000027790
AA Change: P1413L

DomainStartEndE-ValueType
transmembrane domain 13 32 N/A INTRINSIC
PD 51 103 1.92e-12 SMART
Pfam:NtCtMGAM_N 115 224 1.2e-35 PFAM
Pfam:Gal_mutarotas_2 225 294 4.8e-9 PFAM
Pfam:Glyco_hydro_31 314 787 2.1e-142 PFAM
PD 917 972 6.69e-12 SMART
Pfam:NtCtMGAM_N 985 1098 6e-33 PFAM
Blast:ANK 1138 1168 1e-5 BLAST
Pfam:Glyco_hydro_31 1186 1682 8.4e-137 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a sucrase-isomaltase enzyme that is expressed in the intestinal brush border. The encoded protein is synthesized as a precursor protein that is cleaved by pancreatic proteases into two enzymatic subunits sucrase and isomaltase. These two subunits heterodimerize to form the sucrose-isomaltase complex. This complex is essential for the digestion of dietary carbohydrates including starch, sucrose and isomaltose. Mutations in this gene are the cause of congenital sucrase-isomaltase deficiency.[provided by RefSeq, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,799 Y155N probably damaging Het
1700019A02Rik C T 1: 53,163,246 probably null Het
2310022B05Rik A G 8: 124,639,114 F297L probably benign Het
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Agbl3 A G 6: 34,799,255 N227S probably damaging Het
Ak6 C T 13: 100,665,951 Q151* probably null Het
Ano4 A G 10: 89,029,266 L297P probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Ap5s1 G A 2: 131,212,995 W212* probably null Het
Arl9 A G 5: 77,007,406 Q113R probably damaging Het
Atg2b T C 12: 105,661,171 H519R probably damaging Het
Atp1a2 A G 1: 172,298,012 probably benign Het
Atp2b1 G A 10: 99,010,760 A808T probably damaging Het
Bckdhb C A 9: 84,069,184 T342K probably benign Het
Bdp1 T C 13: 100,038,224 H1996R probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Ccdc180 A G 4: 45,926,235 I1148M probably damaging Het
Csf3r T A 4: 126,043,621 M766K probably benign Het
Ctnnd1 T A 2: 84,650,468 probably benign Het
Cyp2c39 A T 19: 39,510,992 N41I probably damaging Het
D2hgdh G T 1: 93,826,460 V52L probably benign Het
Dppa4 T A 16: 48,289,127 Y77* probably null Het
Eif4enif1 T C 11: 3,242,481 S770P probably damaging Het
Fbxl16 A T 17: 25,817,735 D230V probably damaging Het
Gm4847 G A 1: 166,643,448 A11V probably damaging Het
Gm9978 C T 10: 78,487,081 noncoding transcript Het
Gpatch8 A G 11: 102,480,915 L599P unknown Het
Hdac4 A G 1: 91,958,398 L254P probably damaging Het
Heatr1 A G 13: 12,404,947 I384V probably benign Het
Heatr1 A T 13: 12,406,058 Q410L probably benign Het
Hmcn2 A G 2: 31,370,792 I1065V probably benign Het
Igkv6-14 A G 6: 70,435,040 S87P probably damaging Het
Il2rb G T 15: 78,482,066 Q344K possibly damaging Het
Ipo4 A G 14: 55,626,152 probably null Het
Ipo9 A G 1: 135,390,536 probably null Het
Khdrbs1 T C 4: 129,720,094 T374A probably benign Het
Lamc3 G T 2: 31,905,712 G370W probably damaging Het
Lipn T A 19: 34,076,935 L191Q probably damaging Het
Lpl T C 8: 68,901,288 V427A probably benign Het
Magi3 T C 3: 104,105,812 S120G probably damaging Het
Mgl2 T C 11: 70,137,111 *382Q probably null Het
Nab2 G A 10: 127,664,924 Q100* probably null Het
Nfat5 T A 8: 107,355,651 probably null Het
Nqo1 T C 8: 107,388,868 H259R probably damaging Het
Nrd1 T A 4: 109,013,747 D190E probably benign Het
Olfr1030 T A 2: 85,984,804 probably benign Het
Osmr G A 15: 6,815,795 P830L probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pde11a T A 2: 76,017,850 M878L probably benign Het
Pik3ap1 T C 19: 41,385,016 probably benign Het
Pla2g3 T C 11: 3,491,916 L360P probably damaging Het
Plxnc1 A G 10: 94,943,848 V244A probably benign Het
Pramef25 C T 4: 143,950,899 A37T possibly damaging Het
Ptpra T C 2: 130,503,502 V8A probably benign Het
Rbbp5 T C 1: 132,494,340 V199A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A G 1: 4,352,836 V7A possibly damaging Het
Sdk2 T C 11: 113,830,063 T1347A probably benign Het
Sgo2a T A 1: 58,016,959 H767Q probably benign Het
Slc22a5 G T 11: 53,876,020 A214E probably damaging Het
Snx13 G T 12: 35,047,319 probably benign Het
Sun5 T A 2: 153,858,443 I295F probably damaging Het
Themis3 C T 17: 66,593,209 A55T probably damaging Het
Tmem255b T C 8: 13,455,138 Y148H probably benign Het
Tmem74b A G 2: 151,706,719 E122G probably damaging Het
Top3b T C 16: 16,892,892 V862A probably damaging Het
Trim35 A T 14: 66,308,750 D322V probably damaging Het
Trpm2 A G 10: 77,917,713 F1319S probably benign Het
Ttn T A 2: 76,954,676 R756S probably benign Het
Vmn2r108 A T 17: 20,463,006 N645K possibly damaging Het
Vmn2r73 A G 7: 85,872,667 S155P possibly damaging Het
Vstm4 G A 14: 32,863,670 A65T probably benign Het
Other mutations in Sis
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Sis APN 3 72946636 missense probably benign
IGL00715:Sis APN 3 72934124 missense probably damaging 1.00
IGL00721:Sis APN 3 72943579 missense probably damaging 1.00
IGL00766:Sis APN 3 72907237 splice site probably benign
IGL00783:Sis APN 3 72946632 missense probably benign
IGL00805:Sis APN 3 72934199 missense probably benign 0.05
IGL00932:Sis APN 3 72940956 splice site probably benign
IGL01020:Sis APN 3 72966838 missense probably damaging 1.00
IGL01024:Sis APN 3 72911876 missense probably damaging 1.00
IGL01286:Sis APN 3 72941025 missense probably damaging 1.00
IGL01457:Sis APN 3 72961021 missense probably benign
IGL01514:Sis APN 3 72935920 splice site probably benign
IGL01986:Sis APN 3 72945212 missense probably damaging 1.00
IGL02110:Sis APN 3 72928699 nonsense probably null
IGL02132:Sis APN 3 72947471 missense probably benign 0.00
IGL02152:Sis APN 3 72888986 utr 3 prime probably benign
IGL02200:Sis APN 3 72943604 missense probably damaging 0.99
IGL02244:Sis APN 3 72956190 missense probably benign 0.19
IGL02307:Sis APN 3 72911834 splice site probably benign
IGL02374:Sis APN 3 72925456 missense probably benign 0.03
IGL02437:Sis APN 3 72919614 critical splice acceptor site probably null
IGL02571:Sis APN 3 72956304 splice site probably benign
IGL02601:Sis APN 3 72913210 missense probably benign 0.44
IGL03063:Sis APN 3 72928297 missense probably benign
IGL03382:Sis APN 3 72928719 missense probably benign 0.00
IGL03397:Sis APN 3 72935879 missense probably benign 0.44
PIT1430001:Sis UTSW 3 72922829 missense probably damaging 0.97
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0013:Sis UTSW 3 72910476 missense possibly damaging 0.65
R0046:Sis UTSW 3 72932094 missense probably benign 0.01
R0094:Sis UTSW 3 72921437 missense probably damaging 1.00
R0096:Sis UTSW 3 72928267 missense probably damaging 1.00
R0505:Sis UTSW 3 72960296 missense probably benign 0.29
R0544:Sis UTSW 3 72951642 missense probably damaging 1.00
R0551:Sis UTSW 3 72925407 missense possibly damaging 0.79
R0617:Sis UTSW 3 72965605 missense probably damaging 1.00
R0698:Sis UTSW 3 72910498 missense probably damaging 1.00
R0701:Sis UTSW 3 72941045 missense probably damaging 1.00
R0704:Sis UTSW 3 72949822 missense possibly damaging 0.63
R0706:Sis UTSW 3 72952531 missense probably damaging 1.00
R0710:Sis UTSW 3 72952531 missense probably damaging 1.00
R0752:Sis UTSW 3 72952531 missense probably damaging 1.00
R0753:Sis UTSW 3 72952531 missense probably damaging 1.00
R0754:Sis UTSW 3 72952531 missense probably damaging 1.00
R0767:Sis UTSW 3 72952531 missense probably damaging 1.00
R0769:Sis UTSW 3 72952531 missense probably damaging 1.00
R0772:Sis UTSW 3 72952531 missense probably damaging 1.00
R0774:Sis UTSW 3 72952531 missense probably damaging 1.00
R0776:Sis UTSW 3 72952531 missense probably damaging 1.00
R0818:Sis UTSW 3 72952531 missense probably damaging 1.00
R0819:Sis UTSW 3 72952531 missense probably damaging 1.00
R0885:Sis UTSW 3 72911949 nonsense probably null
R1076:Sis UTSW 3 72934098 missense probably damaging 0.97
R1140:Sis UTSW 3 72951616 missense probably damaging 0.98
R1175:Sis UTSW 3 72958104 splice site probably benign
R1301:Sis UTSW 3 72946582 missense possibly damaging 0.76
R1437:Sis UTSW 3 72934142 missense probably damaging 1.00
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1466:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1472:Sis UTSW 3 72889027 missense probably benign 0.12
R1584:Sis UTSW 3 72932060 missense possibly damaging 0.60
R1707:Sis UTSW 3 72909087 splice site probably benign
R1715:Sis UTSW 3 72889010 missense possibly damaging 0.47
R1719:Sis UTSW 3 72965604 missense probably damaging 1.00
R1728:Sis UTSW 3 72965645 nonsense probably null
R1784:Sis UTSW 3 72965645 nonsense probably null
R1820:Sis UTSW 3 72921142 missense probably damaging 1.00
R1972:Sis UTSW 3 72921004 missense probably damaging 1.00
R1973:Sis UTSW 3 72921004 missense probably damaging 1.00
R2054:Sis UTSW 3 72913237 missense probably benign 0.01
R2233:Sis UTSW 3 72913194 missense probably benign 0.03
R2235:Sis UTSW 3 72913194 missense probably benign 0.03
R2276:Sis UTSW 3 72914601 nonsense probably null
R2435:Sis UTSW 3 72911904 missense probably benign 0.01
R2885:Sis UTSW 3 72909173 missense probably benign 0.01
R2966:Sis UTSW 3 72889010 missense probably benign 0.30
R3708:Sis UTSW 3 72943523 missense probably benign 0.02
R3790:Sis UTSW 3 72921414 missense probably damaging 1.00
R3807:Sis UTSW 3 72925596 missense probably benign 0.01
R3858:Sis UTSW 3 72928652 missense probably damaging 0.99
R3974:Sis UTSW 3 72943635 missense probably damaging 0.96
R3975:Sis UTSW 3 72943635 missense probably damaging 0.96
R4037:Sis UTSW 3 72928602 missense probably benign
R4080:Sis UTSW 3 72921184 missense probably damaging 1.00
R4204:Sis UTSW 3 72961082 missense probably benign
R4394:Sis UTSW 3 72956149 missense probably damaging 1.00
R4470:Sis UTSW 3 72928159 splice site probably null
R4573:Sis UTSW 3 72928237 missense possibly damaging 0.94
R4868:Sis UTSW 3 72943548 missense probably benign 0.09
R5023:Sis UTSW 3 72934122 missense probably benign 0.05
R5264:Sis UTSW 3 72949756 missense probably damaging 0.98
R5414:Sis UTSW 3 72952493 missense probably benign
R5462:Sis UTSW 3 72949838 missense probably damaging 0.96
R5523:Sis UTSW 3 72891421 missense probably benign 0.00
R5584:Sis UTSW 3 72910415 missense probably damaging 1.00
R5587:Sis UTSW 3 72914576 missense possibly damaging 0.94
R5725:Sis UTSW 3 72965598 missense probably damaging 1.00
R5769:Sis UTSW 3 72928235 missense probably damaging 0.98
R5790:Sis UTSW 3 72928174 missense probably benign
R5864:Sis UTSW 3 72949818 missense probably damaging 1.00
R5902:Sis UTSW 3 72960256 critical splice donor site probably null
R5925:Sis UTSW 3 72921380 synonymous probably null
R6029:Sis UTSW 3 72928308 missense probably benign 0.30
R6124:Sis UTSW 3 72953211 missense possibly damaging 0.69
R6171:Sis UTSW 3 72961027 missense possibly damaging 0.75
R6182:Sis UTSW 3 72904293 missense probably benign 0.05
R6295:Sis UTSW 3 72966770 missense probably damaging 0.99
R6416:Sis UTSW 3 72911854 missense probably damaging 1.00
R6431:Sis UTSW 3 72958174 missense probably benign 0.00
R6472:Sis UTSW 3 72938734 nonsense probably null
R6517:Sis UTSW 3 72907142 missense probably damaging 1.00
R6701:Sis UTSW 3 72949527 missense probably damaging 1.00
R6796:Sis UTSW 3 72965618 missense probably benign 0.06
R6853:Sis UTSW 3 72891426 missense possibly damaging 0.93
R6906:Sis UTSW 3 72919485 missense probably damaging 1.00
R7058:Sis UTSW 3 72903607 missense probably damaging 0.98
R7357:Sis UTSW 3 72925071 missense probably damaging 1.00
R7381:Sis UTSW 3 72913292 splice site probably null
R7439:Sis UTSW 3 72909041 missense possibly damaging 0.81
R7742:Sis UTSW 3 72925098 missense probably benign 0.19
R7813:Sis UTSW 3 72925468 missense probably benign 0.01
R7883:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7899:Sis UTSW 3 72937251 missense probably damaging 1.00
R7966:Sis UTSW 3 72920996 missense possibly damaging 0.78
R7982:Sis UTSW 3 72937251 missense probably damaging 1.00
R8020:Sis UTSW 3 72908965
R8023:Sis UTSW 3 72952480
R8029:Sis UTSW 3 72921142 missense probably damaging 1.00
R8053:Sis UTSW 3 72949568
R8062:Sis UTSW 3 72920988
R8074:Sis UTSW 3 72917198
X0009:Sis UTSW 3 72889022 missense probably damaging 0.99
X0024:Sis UTSW 3 72928670 missense probably benign
X0060:Sis UTSW 3 72920906 intron probably benign
Z1176:Sis UTSW 3 72904273
Z1176:Sis UTSW 3 72943557
Z1177:Sis UTSW 3 72909172
Z1177:Sis UTSW 3 72910474
Z1177:Sis UTSW 3 72943569
Predicted Primers PCR Primer
(F):5'- AGCTGTCACTAGACCACAATTG -3'
(R):5'- ACAGTAGCAACCCCGTCTTC -3'

Sequencing Primer
(F):5'- TTCCCCTTCCCAGGAAAAATTG -3'
(R):5'- CTTCTGAGTTCTGGCATTATAAGC -3'
Posted On2017-06-26