Mutagenetix > Incidental Mutation

Incidental Mutation 'R6018:Agbl3'

478711

Institutional Source

Beutler Lab

Gene Symbol

Agbl3

Ensembl Gene

ENSMUSG00000038836

Gene Name

ATP/GTP binding protein-like 3

Synonyms

4930431N21Rik, 2900053G10Rik, 6530406M24Rik

MMRRC Submission

044192-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6018 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

34780432-34859459 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 34799255 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 227 (N227S)

Ref Sequence

ENSEMBL: ENSMUSP00000110669 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115016] [ENSMUST00000115017] [ENSMUST00000135304] [ENSMUST00000148834]

AlphaFold

Q8CDP0

Predicted Effect

probably damaging
Transcript: ENSMUST00000115016
AA Change: N232S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110668
Gene: ENSMUSG00000038836
AA Change: N232S

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	314	563	2.7e-19	PFAM
low complexity region	614	629	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000115017
AA Change: N227S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000110669
Gene: ENSMUSG00000038836
AA Change: N227S

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC
Pfam:Peptidase_M14	309	560	1e-33	PFAM
low complexity region	609	624	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000135304

SMART Domains

Protein: ENSMUSP00000118303
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143474

Predicted Effect

probably benign
Transcript: ENSMUST00000148834

SMART Domains

Protein: ENSMUSP00000116066
Gene: ENSMUSG00000038836

Domain	Start	End	E-Value	Type
low complexity region	2	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155726

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155890

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202017

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.6%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a targeted allele are viable and fertile. Mice homozygous for a knock-out allele exhibit normal response to herpes simplex virus (HSV) and vaccinia virus (VACV) infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,799	Y155N	probably damaging	Het
1700019A02Rik	C	T	1: 53,163,246		probably null	Het
2310022B05Rik	A	G	8: 124,639,114	F297L	probably benign	Het
Acbd3	T	C	1: 180,752,338	S516P	possibly damaging	Het
Ak6	C	T	13: 100,665,951	Q151*	probably null	Het
Ano4	A	G	10: 89,029,266	L297P	probably benign	Het
Anxa5	T	C	3: 36,450,658	T252A	probably benign	Het
Ap5s1	G	A	2: 131,212,995	W212*	probably null	Het
Arl9	A	G	5: 77,007,406	Q113R	probably damaging	Het
Atg2b	T	C	12: 105,661,171	H519R	probably damaging	Het
Atp1a2	A	G	1: 172,298,012		probably benign	Het
Atp2b1	G	A	10: 99,010,760	A808T	probably damaging	Het
Bckdhb	C	A	9: 84,069,184	T342K	probably benign	Het
Bdp1	T	C	13: 100,038,224	H1996R	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Ccdc180	A	G	4: 45,926,235	I1148M	probably damaging	Het
Csf3r	T	A	4: 126,043,621	M766K	probably benign	Het
Ctnnd1	T	A	2: 84,650,468		probably benign	Het
Cyp2c39	A	T	19: 39,510,992	N41I	probably damaging	Het
D2hgdh	G	T	1: 93,826,460	V52L	probably benign	Het
Dppa4	T	A	16: 48,289,127	Y77*	probably null	Het
Eif4enif1	T	C	11: 3,242,481	S770P	probably damaging	Het
Fbxl16	A	T	17: 25,817,735	D230V	probably damaging	Het
Gm4847	G	A	1: 166,643,448	A11V	probably damaging	Het
Gm9978	C	T	10: 78,487,081		noncoding transcript	Het
Gpatch8	A	G	11: 102,480,915	L599P	unknown	Het
Hdac4	A	G	1: 91,958,398	L254P	probably damaging	Het
Heatr1	A	G	13: 12,404,947	I384V	probably benign	Het
Heatr1	A	T	13: 12,406,058	Q410L	probably benign	Het
Hmcn2	A	G	2: 31,370,792	I1065V	probably benign	Het
Igkv6-14	A	G	6: 70,435,040	S87P	probably damaging	Het
Il2rb	G	T	15: 78,482,066	Q344K	possibly damaging	Het
Ipo4	A	G	14: 55,626,152		probably null	Het
Ipo9	A	G	1: 135,390,536		probably null	Het
Khdrbs1	T	C	4: 129,720,094	T374A	probably benign	Het
Lamc3	G	T	2: 31,905,712	G370W	probably damaging	Het
Lipn	T	A	19: 34,076,935	L191Q	probably damaging	Het
Lpl	T	C	8: 68,901,288	V427A	probably benign	Het
Magi3	T	C	3: 104,105,812	S120G	probably damaging	Het
Mgl2	T	C	11: 70,137,111	*382Q	probably null	Het
Nab2	G	A	10: 127,664,924	Q100*	probably null	Het
Nfat5	T	A	8: 107,355,651		probably null	Het
Nqo1	T	C	8: 107,388,868	H259R	probably damaging	Het
Nrd1	T	A	4: 109,013,747	D190E	probably benign	Het
Olfr1030	T	A	2: 85,984,804		probably benign	Het
Osmr	G	A	15: 6,815,795	P830L	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Pde11a	T	A	2: 76,017,850	M878L	probably benign	Het
Pik3ap1	T	C	19: 41,385,016		probably benign	Het
Pla2g3	T	C	11: 3,491,916	L360P	probably damaging	Het
Plxnc1	A	G	10: 94,943,848	V244A	probably benign	Het
Pramef25	C	T	4: 143,950,899	A37T	possibly damaging	Het
Ptpra	T	C	2: 130,503,502	V8A	probably benign	Het
Rbbp5	T	C	1: 132,494,340	V199A	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	G	1: 4,352,836	V7A	possibly damaging	Het
Sdk2	T	C	11: 113,830,063	T1347A	probably benign	Het
Sgo2a	T	A	1: 58,016,959	H767Q	probably benign	Het
Sis	G	A	3: 72,913,192	P1413L	possibly damaging	Het
Slc22a5	G	T	11: 53,876,020	A214E	probably damaging	Het
Snx13	G	T	12: 35,047,319		probably benign	Het
Sun5	T	A	2: 153,858,443	I295F	probably damaging	Het
Themis3	C	T	17: 66,593,209	A55T	probably damaging	Het
Tmem255b	T	C	8: 13,455,138	Y148H	probably benign	Het
Tmem74b	A	G	2: 151,706,719	E122G	probably damaging	Het
Top3b	T	C	16: 16,892,892	V862A	probably damaging	Het
Trim35	A	T	14: 66,308,750	D322V	probably damaging	Het
Trpm2	A	G	10: 77,917,713	F1319S	probably benign	Het
Ttn	T	A	2: 76,954,676	R756S	probably benign	Het
Vmn2r108	A	T	17: 20,463,006	N645K	possibly damaging	Het
Vmn2r73	A	G	7: 85,872,667	S155P	possibly damaging	Het
Vstm4	G	A	14: 32,863,670	A65T	probably benign	Het

Other mutations in Agbl3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00336:Agbl3	APN	6	34846836	missense	probably damaging	1.00
IGL00835:Agbl3	APN	6	34799732	missense	probably damaging	1.00
IGL00840:Agbl3	APN	6	34799159	missense	possibly damaging	0.95
IGL01090:Agbl3	APN	6	34799887	missense	probably benign	0.40
IGL01123:Agbl3	APN	6	34846976	nonsense	probably null
IGL01707:Agbl3	APN	6	34839454	missense	possibly damaging	0.78
IGL01728:Agbl3	APN	6	34782157	start codon destroyed	probably null
IGL02335:Agbl3	APN	6	34799750	missense	probably damaging	1.00
IGL02420:Agbl3	APN	6	34785307	missense	possibly damaging	0.47
IGL02551:Agbl3	APN	6	34823071	missense	possibly damaging	0.88
IGL02974:Agbl3	APN	6	34799822	missense	probably damaging	1.00
IGL03167:Agbl3	APN	6	34857659	missense	possibly damaging	0.92
IGL03182:Agbl3	APN	6	34803500	missense	probably damaging	1.00
R0044:Agbl3	UTSW	6	34799899	missense	probably damaging	1.00
R0499:Agbl3	UTSW	6	34839335	missense	probably benign
R0639:Agbl3	UTSW	6	34799705	missense	probably damaging	1.00
R0850:Agbl3	UTSW	6	34799204	missense	probably damaging	1.00
R1004:Agbl3	UTSW	6	34803451	missense	probably damaging	0.99
R1080:Agbl3	UTSW	6	34828235	missense	probably benign	0.14
R1589:Agbl3	UTSW	6	34857517	missense	possibly damaging	0.77
R2361:Agbl3	UTSW	6	34832505	missense	possibly damaging	0.87
R2495:Agbl3	UTSW	6	34846764	missense	probably damaging	1.00
R3236:Agbl3	UTSW	6	34823087	splice site	probably null
R3237:Agbl3	UTSW	6	34823087	splice site	probably null
R3420:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3421:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3422:Agbl3	UTSW	6	34793965	missense	probably benign	0.36
R3810:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R3811:Agbl3	UTSW	6	34799729	missense	probably damaging	1.00
R4059:Agbl3	UTSW	6	34846899	missense	probably damaging	1.00
R4499:Agbl3	UTSW	6	34857598	missense	probably benign	0.00
R4687:Agbl3	UTSW	6	34798326	missense	probably damaging	1.00
R4854:Agbl3	UTSW	6	34785284	missense	probably damaging	0.97
R5354:Agbl3	UTSW	6	34814752	missense	probably benign	0.03
R5386:Agbl3	UTSW	6	34799196	missense	probably damaging	1.00
R5897:Agbl3	UTSW	6	34803573	missense	probably benign	0.21
R6148:Agbl3	UTSW	6	34857753	missense	possibly damaging	0.87
R6305:Agbl3	UTSW	6	34782210	missense	unknown
R6525:Agbl3	UTSW	6	34803594	nonsense	probably null
R6546:Agbl3	UTSW	6	34799299	missense	probably damaging	1.00
R6743:Agbl3	UTSW	6	34846953	missense	probably benign	0.03
R6986:Agbl3	UTSW	6	34839452	missense	probably benign	0.42
R7023:Agbl3	UTSW	6	34814769	missense	probably benign	0.02
R7411:Agbl3	UTSW	6	34814819	missense	probably damaging	0.99
R7469:Agbl3	UTSW	6	34814414	missense	probably damaging	1.00
R7631:Agbl3	UTSW	6	34857671	missense	possibly damaging	0.95
R7658:Agbl3	UTSW	6	34832508	missense	probably benign	0.11
R7743:Agbl3	UTSW	6	34846830	missense	probably damaging	1.00
R7801:Agbl3	UTSW	6	34839365	missense	probably benign	0.00
R8033:Agbl3	UTSW	6	34839494	missense	possibly damaging	0.95
R8203:Agbl3	UTSW	6	34799479	missense	probably damaging	1.00
R8769:Agbl3	UTSW	6	34857614	missense	probably damaging	0.96
R9072:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9073:Agbl3	UTSW	6	34799452	missense	probably damaging	1.00
R9210:Agbl3	UTSW	6	34798242	missense	probably damaging	0.98
R9255:Agbl3	UTSW	6	34812905	missense	probably damaging	1.00
R9536:Agbl3	UTSW	6	34846926	missense	probably benign
R9560:Agbl3	UTSW	6	34846908	missense	possibly damaging	0.94
R9662:Agbl3	UTSW	6	34832533	nonsense	probably null
RF014:Agbl3	UTSW	6	34799358	missense	possibly damaging	0.53
Z1177:Agbl3	UTSW	6	34799408	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGAATGAATGCTAAGGCTACC -3'
(R):5'- TCCTGGCTGTGTGGAAACTG -3'

Sequencing Primer
(F):5'- GTTTCCTCCCAAAAAGTTTCTATGAC -3'
(R):5'- CTGTGTGGAAACTGAAATGTCCAC -3'

Posted On

2017-06-26