Mutagenetix > Incidental Mutations

Incidental Mutation 'R6018:Rnd2'

478730

Institutional Source

Beutler Lab

Gene Symbol

Rnd2

Ensembl Gene

ENSMUSG00000001313

Gene Name

Rho family GTPase 2

Synonyms

Arhn, Rohn

MMRRC Submission

044192-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6018 (G1)

Quality Score

199.009

Status

Not validated

Chromosome

Chromosomal Location

101464999-101471853 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101468999 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 57 (L57F)

Ref Sequence

ENSEMBL: ENSMUSP00000001347 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001347] [ENSMUST00000040430]

Predicted Effect

probably damaging
Transcript: ENSMUST00000001347
AA Change: L57F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000001347
Gene: ENSMUSG00000001313
AA Change: L57F

Domain	Start	End	E-Value	Type
RHO	10	184	5.22e-100	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000040430

SMART Domains

Protein: ENSMUSP00000048350
Gene: ENSMUSG00000034993

Domain	Start	End	E-Value	Type
low complexity region	3	31	N/A	INTRINSIC
low complexity region	41	60	N/A	INTRINSIC
Pfam:ADH_N	89	157	8.8e-11	PFAM
Pfam:ADH_zinc_N	213	355	2.1e-21	PFAM
Pfam:ADH_zinc_N_2	245	398	6.9e-22	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134980

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153185

Meta Mutation Damage Score

0.1630

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho GTPase family, whose members play a key role in the regulation of actin cytoskeleton organization in response to extracellular growth factors. This particular family member has been implicated in the regulation of neuronal morphology and endosomal trafficking. The gene localizes to chromosome 17 and is the centromeric neighbor of the breast-ovarian cancer susceptibility gene BRCA1. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,799	Y155N	probably damaging	Het
1700019A02Rik	C	T	1: 53,163,246		probably null	Het
2310022B05Rik	A	G	8: 124,639,114	F297L	probably benign	Het
Acbd3	T	C	1: 180,752,338	S516P	possibly damaging	Het
Agbl3	A	G	6: 34,799,255	N227S	probably damaging	Het
Ak6	C	T	13: 100,665,951	Q151*	probably null	Het
Ano4	A	G	10: 89,029,266	L297P	probably benign	Het
Anxa5	T	C	3: 36,450,658	T252A	probably benign	Het
Ap5s1	G	A	2: 131,212,995	W212*	probably null	Het
Arl9	A	G	5: 77,007,406	Q113R	probably damaging	Het
Atg2b	T	C	12: 105,661,171	H519R	probably damaging	Het
Atp1a2	A	G	1: 172,298,012		probably benign	Het
Atp2b1	G	A	10: 99,010,760	A808T	probably damaging	Het
Bckdhb	C	A	9: 84,069,184	T342K	probably benign	Het
Bdp1	T	C	13: 100,038,224	H1996R	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Ccdc180	A	G	4: 45,926,235	I1148M	probably damaging	Het
Csf3r	T	A	4: 126,043,621	M766K	probably benign	Het
Ctnnd1	T	A	2: 84,650,468		probably benign	Het
Cyp2c39	A	T	19: 39,510,992	N41I	probably damaging	Het
D2hgdh	G	T	1: 93,826,460	V52L	probably benign	Het
Dppa4	T	A	16: 48,289,127	Y77*	probably null	Het
Eif4enif1	T	C	11: 3,242,481	S770P	probably damaging	Het
Fbxl16	A	T	17: 25,817,735	D230V	probably damaging	Het
Gm4847	G	A	1: 166,643,448	A11V	probably damaging	Het
Gm9978	C	T	10: 78,487,081		noncoding transcript	Het
Gpatch8	A	G	11: 102,480,915	L599P	unknown	Het
Hdac4	A	G	1: 91,958,398	L254P	probably damaging	Het
Heatr1	A	G	13: 12,404,947	I384V	probably benign	Het
Heatr1	A	T	13: 12,406,058	Q410L	probably benign	Het
Hmcn2	A	G	2: 31,370,792	I1065V	probably benign	Het
Igkv6-14	A	G	6: 70,435,040	S87P	probably damaging	Het
Il2rb	G	T	15: 78,482,066	Q344K	possibly damaging	Het
Ipo4	A	G	14: 55,626,152		probably null	Het
Ipo9	A	G	1: 135,390,536		probably null	Het
Khdrbs1	T	C	4: 129,720,094	T374A	probably benign	Het
Lamc3	G	T	2: 31,905,712	G370W	probably damaging	Het
Lipn	T	A	19: 34,076,935	L191Q	probably damaging	Het
Lpl	T	C	8: 68,901,288	V427A	probably benign	Het
Magi3	T	C	3: 104,105,812	S120G	probably damaging	Het
Mgl2	T	C	11: 70,137,111	*382Q	probably null	Het
Nab2	G	A	10: 127,664,924	Q100*	probably null	Het
Nfat5	T	A	8: 107,355,651		probably null	Het
Nqo1	T	C	8: 107,388,868	H259R	probably damaging	Het
Nrd1	T	A	4: 109,013,747	D190E	probably benign	Het
Olfr1030	T	A	2: 85,984,804		probably benign	Het
Osmr	G	A	15: 6,815,795	P830L	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Pde11a	T	A	2: 76,017,850	M878L	probably benign	Het
Pik3ap1	T	C	19: 41,385,016		probably benign	Het
Pla2g3	T	C	11: 3,491,916	L360P	probably damaging	Het
Plxnc1	A	G	10: 94,943,848	V244A	probably benign	Het
Pramef25	C	T	4: 143,950,899	A37T	possibly damaging	Het
Ptpra	T	C	2: 130,503,502	V8A	probably benign	Het
Rbbp5	T	C	1: 132,494,340	V199A	probably damaging	Het
Rp1	A	G	1: 4,352,836	V7A	possibly damaging	Het
Sdk2	T	C	11: 113,830,063	T1347A	probably benign	Het
Sgo2a	T	A	1: 58,016,959	H767Q	probably benign	Het
Sis	G	A	3: 72,913,192	P1413L	possibly damaging	Het
Slc22a5	G	T	11: 53,876,020	A214E	probably damaging	Het
Snx13	G	T	12: 35,047,319		probably benign	Het
Sun5	T	A	2: 153,858,443	I295F	probably damaging	Het
Themis3	C	T	17: 66,593,209	A55T	probably damaging	Het
Tmem255b	T	C	8: 13,455,138	Y148H	probably benign	Het
Tmem74b	A	G	2: 151,706,719	E122G	probably damaging	Het
Top3b	T	C	16: 16,892,892	V862A	probably damaging	Het
Trim35	A	T	14: 66,308,750	D322V	probably damaging	Het
Trpm2	A	G	10: 77,917,713	F1319S	probably benign	Het
Ttn	T	A	2: 76,954,676	R756S	probably benign	Het
Vmn2r108	A	T	17: 20,463,006	N645K	possibly damaging	Het
Vmn2r73	A	G	7: 85,872,667	S155P	possibly damaging	Het
Vstm4	G	A	14: 32,863,670	A65T	probably benign	Het

Other mutations in Rnd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Rnd2	APN	11	101471191	missense	possibly damaging	0.81
IGL01964:Rnd2	APN	11	101470806	splice site	probably null
Atkins	UTSW	11	101468999	missense	probably damaging	1.00
R1581:Rnd2	UTSW	11	101471196	missense	probably benign
R4606:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4797:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4824:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4825:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R4931:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5005:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5078:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5079:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5402:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5405:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5497:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5498:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5501:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5534:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5619:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5666:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5669:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5670:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5671:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5786:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5788:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5844:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5845:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5857:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5989:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5991:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R5992:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6019:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6020:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6122:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6144:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6148:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6208:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6209:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6226:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6230:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6332:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6333:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6335:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6491:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6541:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6605:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6606:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6607:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6677:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6678:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6726:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6796:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R6797:Rnd2	UTSW	11	101468999	missense	probably damaging	1.00
R8415:Rnd2	UTSW	11	101471185	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CAGACCAACTTCTGTCTAGGG -3'
(R):5'- AGACTTCCTACGTGGTTTCTG -3'

Sequencing Primer
(F):5'- ACCAACTTCTGTCTAGGGACTGAG -3'
(R):5'- GGTTTCTGTCAGGCCTAAGAAACTC -3'

Posted On

2017-06-26