Incidental Mutation 'R6018:Bdp1'
ID478737
Institutional Source Beutler Lab
Gene Symbol Bdp1
Ensembl Gene ENSMUSG00000049658
Gene NameB double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
SynonymsTAF3B1, TFC5, Tfnr, B130055N23Rik, TFIIIB90, TFIIIB150, G630013P12Rik
MMRRC Submission 044192-MU
Accession Numbers

Genbank: NM_001081061; MGI: 1347077

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6018 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location100017994-100104070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100038224 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 1996 (H1996R)
Ref Sequence ENSEMBL: ENSMUSP00000105005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038104] [ENSMUST00000109379]
Predicted Effect probably benign
Transcript: ENSMUST00000038104
AA Change: H1996R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000038321
Gene: ENSMUSG00000049658
AA Change: H1996R

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 375 399 N/A INTRINSIC
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 3.56e-18 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 3.56e-18 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099262
Predicted Effect probably benign
Transcript: ENSMUST00000109379
AA Change: H1996R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105005
Gene: ENSMUSG00000049658
AA Change: H1996R

DomainStartEndE-ValueType
low complexity region 25 45 N/A INTRINSIC
low complexity region 81 92 N/A INTRINSIC
low complexity region 147 164 N/A INTRINSIC
low complexity region 231 242 N/A INTRINSIC
SANT 301 349 1.52e-4 SMART
coiled coil region 457 487 N/A INTRINSIC
internal_repeat_1 593 895 4.79e-19 PROSPERO
coiled coil region 1013 1038 N/A INTRINSIC
internal_repeat_1 1253 1612 4.79e-19 PROSPERO
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1763 1774 N/A INTRINSIC
low complexity region 1912 1921 N/A INTRINSIC
low complexity region 2185 2199 N/A INTRINSIC
low complexity region 2335 2346 N/A INTRINSIC
low complexity region 2398 2412 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a subunit of the TFIIIB transcription initiation complex, which recruits RNA polymerase III to target promoters in order to initiate transcription. The encoded protein localizes to concentrated aggregates in the nucleus, and is required for transcription from all three types of polymerase III promoters. It is phosphorylated by casein kinase II during mitosis, resulting in its release from chromatin and suppression of polymerase III transcription. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,799 Y155N probably damaging Het
1700019A02Rik C T 1: 53,163,246 probably null Het
2310022B05Rik A G 8: 124,639,114 F297L probably benign Het
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Agbl3 A G 6: 34,799,255 N227S probably damaging Het
Ak6 C T 13: 100,665,951 Q151* probably null Het
Ano4 A G 10: 89,029,266 L297P probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Ap5s1 G A 2: 131,212,995 W212* probably null Het
Arl9 A G 5: 77,007,406 Q113R probably damaging Het
Atg2b T C 12: 105,661,171 H519R probably damaging Het
Atp1a2 A G 1: 172,298,012 probably benign Het
Atp2b1 G A 10: 99,010,760 A808T probably damaging Het
Bckdhb C A 9: 84,069,184 T342K probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Ccdc180 A G 4: 45,926,235 I1148M probably damaging Het
Csf3r T A 4: 126,043,621 M766K probably benign Het
Ctnnd1 T A 2: 84,650,468 probably benign Het
Cyp2c39 A T 19: 39,510,992 N41I probably damaging Het
D2hgdh G T 1: 93,826,460 V52L probably benign Het
Dppa4 T A 16: 48,289,127 Y77* probably null Het
Eif4enif1 T C 11: 3,242,481 S770P probably damaging Het
Fbxl16 A T 17: 25,817,735 D230V probably damaging Het
Gm4847 G A 1: 166,643,448 A11V probably damaging Het
Gm9978 C T 10: 78,487,081 noncoding transcript Het
Gpatch8 A G 11: 102,480,915 L599P unknown Het
Hdac4 A G 1: 91,958,398 L254P probably damaging Het
Heatr1 A G 13: 12,404,947 I384V probably benign Het
Heatr1 A T 13: 12,406,058 Q410L probably benign Het
Hmcn2 A G 2: 31,370,792 I1065V probably benign Het
Igkv6-14 A G 6: 70,435,040 S87P probably damaging Het
Il2rb G T 15: 78,482,066 Q344K possibly damaging Het
Ipo4 A G 14: 55,626,152 probably null Het
Ipo9 A G 1: 135,390,536 probably null Het
Khdrbs1 T C 4: 129,720,094 T374A probably benign Het
Lamc3 G T 2: 31,905,712 G370W probably damaging Het
Lipn T A 19: 34,076,935 L191Q probably damaging Het
Lpl T C 8: 68,901,288 V427A probably benign Het
Magi3 T C 3: 104,105,812 S120G probably damaging Het
Mgl2 T C 11: 70,137,111 *382Q probably null Het
Nab2 G A 10: 127,664,924 Q100* probably null Het
Nfat5 T A 8: 107,355,651 probably null Het
Nqo1 T C 8: 107,388,868 H259R probably damaging Het
Nrd1 T A 4: 109,013,747 D190E probably benign Het
Olfr1030 T A 2: 85,984,804 probably benign Het
Osmr G A 15: 6,815,795 P830L probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pde11a T A 2: 76,017,850 M878L probably benign Het
Pik3ap1 T C 19: 41,385,016 probably benign Het
Pla2g3 T C 11: 3,491,916 L360P probably damaging Het
Plxnc1 A G 10: 94,943,848 V244A probably benign Het
Pramef25 C T 4: 143,950,899 A37T possibly damaging Het
Ptpra T C 2: 130,503,502 V8A probably benign Het
Rbbp5 T C 1: 132,494,340 V199A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A G 1: 4,352,836 V7A possibly damaging Het
Sdk2 T C 11: 113,830,063 T1347A probably benign Het
Sgo2a T A 1: 58,016,959 H767Q probably benign Het
Sis G A 3: 72,913,192 P1413L possibly damaging Het
Slc22a5 G T 11: 53,876,020 A214E probably damaging Het
Snx13 G T 12: 35,047,319 probably benign Het
Sun5 T A 2: 153,858,443 I295F probably damaging Het
Themis3 C T 17: 66,593,209 A55T probably damaging Het
Tmem255b T C 8: 13,455,138 Y148H probably benign Het
Tmem74b A G 2: 151,706,719 E122G probably damaging Het
Top3b T C 16: 16,892,892 V862A probably damaging Het
Trim35 A T 14: 66,308,750 D322V probably damaging Het
Trpm2 A G 10: 77,917,713 F1319S probably benign Het
Ttn T A 2: 76,954,676 R756S probably benign Het
Vmn2r108 A T 17: 20,463,006 N645K possibly damaging Het
Vmn2r73 A G 7: 85,872,667 S155P possibly damaging Het
Vstm4 G A 14: 32,863,670 A65T probably benign Het
Other mutations in Bdp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Bdp1 APN 13 100098510 missense probably damaging 1.00
IGL00096:Bdp1 APN 13 100060865 missense possibly damaging 0.61
IGL00160:Bdp1 APN 13 100061198 missense probably benign 0.00
IGL00924:Bdp1 APN 13 100097579 missense possibly damaging 0.89
IGL01337:Bdp1 APN 13 100056192 missense probably benign 0.00
IGL01344:Bdp1 APN 13 100078080 missense probably benign 0.06
IGL01347:Bdp1 APN 13 100070203 missense possibly damaging 0.79
IGL01620:Bdp1 APN 13 100084205 splice site probably benign
IGL01871:Bdp1 APN 13 100066053 missense probably benign 0.01
IGL02008:Bdp1 APN 13 100023827 missense possibly damaging 0.92
IGL02112:Bdp1 APN 13 100037800 missense probably benign 0.02
IGL02214:Bdp1 APN 13 100041535 missense probably benign 0.00
IGL02236:Bdp1 APN 13 100060891 missense probably benign
IGL02307:Bdp1 APN 13 100093438 missense probably damaging 1.00
IGL02364:Bdp1 APN 13 100055308 splice site probably benign
IGL02415:Bdp1 APN 13 100089408 missense probably damaging 0.96
IGL02601:Bdp1 APN 13 100098514 missense possibly damaging 0.72
IGL02605:Bdp1 APN 13 100078115 critical splice acceptor site probably null
IGL02664:Bdp1 APN 13 100051539 missense probably benign 0.29
IGL02738:Bdp1 APN 13 100051353 missense probably benign 0.26
IGL02754:Bdp1 APN 13 100060973 missense possibly damaging 0.94
IGL02967:Bdp1 APN 13 100042270 missense possibly damaging 0.92
IGL02974:Bdp1 APN 13 100055292 missense probably benign 0.00
IGL03156:Bdp1 APN 13 100061036 missense probably benign 0.44
IGL03166:Bdp1 APN 13 100035800 missense probably benign 0.28
IGL03232:Bdp1 APN 13 100051481 missense probably damaging 1.00
D3080:Bdp1 UTSW 13 100023621 missense probably benign 0.02
R0115:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0481:Bdp1 UTSW 13 100041454 missense probably benign 0.28
R0619:Bdp1 UTSW 13 100037858 missense probably benign 0.00
R0730:Bdp1 UTSW 13 100058951 splice site probably benign
R0744:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R0833:Bdp1 UTSW 13 100035825 missense probably benign 0.01
R1307:Bdp1 UTSW 13 100049763 missense possibly damaging 0.89
R1325:Bdp1 UTSW 13 100099008 missense probably damaging 0.97
R1346:Bdp1 UTSW 13 100078755 nonsense probably null
R1644:Bdp1 UTSW 13 100060940 missense probably benign 0.03
R1670:Bdp1 UTSW 13 100027433 critical splice donor site probably null
R1836:Bdp1 UTSW 13 100035145 missense probably benign
R1869:Bdp1 UTSW 13 100042201 missense probably damaging 0.99
R1920:Bdp1 UTSW 13 100098589 missense probably benign 0.30
R1944:Bdp1 UTSW 13 100074381 splice site probably null
R2030:Bdp1 UTSW 13 100061189 missense probably benign 0.00
R2069:Bdp1 UTSW 13 100050988 missense probably benign 0.00
R2180:Bdp1 UTSW 13 100061405 small insertion probably benign
R2263:Bdp1 UTSW 13 100066037 missense probably damaging 0.96
R2277:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2277:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2278:Bdp1 UTSW 13 100061330 missense probably benign 0.05
R2278:Bdp1 UTSW 13 100061339 missense probably damaging 1.00
R2336:Bdp1 UTSW 13 100053002 missense probably damaging 0.99
R2380:Bdp1 UTSW 13 100060370 missense probably benign 0.08
R3154:Bdp1 UTSW 13 100049814 missense probably damaging 1.00
R4212:Bdp1 UTSW 13 100059585 missense probably benign
R4322:Bdp1 UTSW 13 100092223 missense probably damaging 0.97
R4414:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4415:Bdp1 UTSW 13 100030861 missense probably damaging 0.99
R4764:Bdp1 UTSW 13 100056267 missense probably damaging 0.99
R4766:Bdp1 UTSW 13 100049868 missense probably damaging 0.96
R4888:Bdp1 UTSW 13 100051119 missense probably benign 0.26
R4914:Bdp1 UTSW 13 100056336 missense probably benign 0.28
R4917:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R4918:Bdp1 UTSW 13 100055205 missense probably damaging 0.99
R5170:Bdp1 UTSW 13 100030794 nonsense probably null
R5266:Bdp1 UTSW 13 100067535 missense probably benign 0.33
R5312:Bdp1 UTSW 13 100097601 splice site probably null
R5420:Bdp1 UTSW 13 100066043 missense possibly damaging 0.88
R5486:Bdp1 UTSW 13 100098510 missense probably damaging 1.00
R5909:Bdp1 UTSW 13 100092286 missense probably benign 0.08
R5913:Bdp1 UTSW 13 100051104 missense probably benign 0.41
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6037:Bdp1 UTSW 13 100027449 missense possibly damaging 0.65
R6700:Bdp1 UTSW 13 100025528 missense probably benign 0.00
R6969:Bdp1 UTSW 13 100074531 missense probably damaging 0.97
R6972:Bdp1 UTSW 13 100037761 missense probably null 1.00
R6996:Bdp1 UTSW 13 100043813 missense probably damaging 1.00
R7043:Bdp1 UTSW 13 100078707 missense probably benign 0.03
R7060:Bdp1 UTSW 13 100059494 missense probably damaging 1.00
R7105:Bdp1 UTSW 13 100070181 missense probably damaging 1.00
R7155:Bdp1 UTSW 13 100061151 missense possibly damaging 0.93
R7175:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7177:Bdp1 UTSW 13 100049970 missense probably damaging 0.97
R7327:Bdp1 UTSW 13 100041532 missense probably damaging 0.97
R7512:Bdp1 UTSW 13 100050949 missense probably benign 0.03
R7562:Bdp1 UTSW 13 100025541 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CCAGTGGAATTCTGTGGCTG -3'
(R):5'- AATCTTGGCAAACCCCATTCTTTTG -3'

Sequencing Primer
(F):5'- AATTCTGTGGCTGGCGAAAG -3'
(R):5'- CATTCTTTTGCCTTGTGAATTAGCTG -3'
Posted On2017-06-26