Incidental Mutation 'R6018:Ipo4'
ID478740
Institutional Source Beutler Lab
Gene Symbol Ipo4
Ensembl Gene ENSMUSG00000002319
Gene Nameimportin 4
Synonyms
MMRRC Submission 044192-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6018 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55625400-55635957 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 55626152 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002395] [ENSMUST00000047131] [ENSMUST00000135221] [ENSMUST00000141499] [ENSMUST00000148351]
Predicted Effect probably benign
Transcript: ENSMUST00000002395
SMART Domains Protein: ENSMUSP00000002395
Gene: ENSMUSG00000002324

DomainStartEndE-ValueType
Pfam:Rad21_Rec8_N 1 117 2.2e-26 PFAM
low complexity region 235 249 N/A INTRINSIC
low complexity region 329 347 N/A INTRINSIC
coiled coil region 423 458 N/A INTRINSIC
low complexity region 497 521 N/A INTRINSIC
Pfam:Rad21_Rec8 536 590 9.2e-23 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000047131
SMART Domains Protein: ENSMUSP00000036555
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 4e-20 BLAST
Blast:IBN_N 224 293 4e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.7e-7 PFAM
Blast:ARM 465 499 8e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
low complexity region 811 830 N/A INTRINSIC
low complexity region 851 864 N/A INTRINSIC
Pfam:HEAT 901 931 1.9e-5 PFAM
Pfam:HEAT_EZ 914 969 2.3e-9 PFAM
low complexity region 1043 1053 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126064
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127773
Predicted Effect probably benign
Transcript: ENSMUST00000135221
SMART Domains Protein: ENSMUSP00000123692
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Blast:IBN_N 101 170 3e-20 BLAST
Blast:IBN_N 224 293 2e-31 BLAST
low complexity region 307 321 N/A INTRINSIC
Pfam:HEAT 395 425 7.4e-7 PFAM
Blast:ARM 465 499 7e-13 BLAST
low complexity region 500 511 N/A INTRINSIC
low complexity region 636 660 N/A INTRINSIC
low complexity region 733 743 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141425
Predicted Effect probably null
Transcript: ENSMUST00000141499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146528
Predicted Effect probably benign
Transcript: ENSMUST00000148351
SMART Domains Protein: ENSMUSP00000117543
Gene: ENSMUSG00000002319

DomainStartEndE-ValueType
IBN_N 24 90 4.4e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155193
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155464
Predicted Effect probably benign
Transcript: ENSMUST00000156420
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227922
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228754
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.3%
  • 20x: 91.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006A11Rik A T 3: 124,416,799 Y155N probably damaging Het
1700019A02Rik C T 1: 53,163,246 probably null Het
2310022B05Rik A G 8: 124,639,114 F297L probably benign Het
Acbd3 T C 1: 180,752,338 S516P possibly damaging Het
Agbl3 A G 6: 34,799,255 N227S probably damaging Het
Ak6 C T 13: 100,665,951 Q151* probably null Het
Ano4 A G 10: 89,029,266 L297P probably benign Het
Anxa5 T C 3: 36,450,658 T252A probably benign Het
Ap5s1 G A 2: 131,212,995 W212* probably null Het
Arl9 A G 5: 77,007,406 Q113R probably damaging Het
Atg2b T C 12: 105,661,171 H519R probably damaging Het
Atp1a2 A G 1: 172,298,012 probably benign Het
Atp2b1 G A 10: 99,010,760 A808T probably damaging Het
Bckdhb C A 9: 84,069,184 T342K probably benign Het
Bdp1 T C 13: 100,038,224 H1996R probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Ccdc180 A G 4: 45,926,235 I1148M probably damaging Het
Csf3r T A 4: 126,043,621 M766K probably benign Het
Ctnnd1 T A 2: 84,650,468 probably benign Het
Cyp2c39 A T 19: 39,510,992 N41I probably damaging Het
D2hgdh G T 1: 93,826,460 V52L probably benign Het
Dppa4 T A 16: 48,289,127 Y77* probably null Het
Eif4enif1 T C 11: 3,242,481 S770P probably damaging Het
Fbxl16 A T 17: 25,817,735 D230V probably damaging Het
Gm4847 G A 1: 166,643,448 A11V probably damaging Het
Gm9978 C T 10: 78,487,081 noncoding transcript Het
Gpatch8 A G 11: 102,480,915 L599P unknown Het
Hdac4 A G 1: 91,958,398 L254P probably damaging Het
Heatr1 A G 13: 12,404,947 I384V probably benign Het
Heatr1 A T 13: 12,406,058 Q410L probably benign Het
Hmcn2 A G 2: 31,370,792 I1065V probably benign Het
Igkv6-14 A G 6: 70,435,040 S87P probably damaging Het
Il2rb G T 15: 78,482,066 Q344K possibly damaging Het
Ipo9 A G 1: 135,390,536 probably null Het
Khdrbs1 T C 4: 129,720,094 T374A probably benign Het
Lamc3 G T 2: 31,905,712 G370W probably damaging Het
Lipn T A 19: 34,076,935 L191Q probably damaging Het
Lpl T C 8: 68,901,288 V427A probably benign Het
Magi3 T C 3: 104,105,812 S120G probably damaging Het
Mgl2 T C 11: 70,137,111 *382Q probably null Het
Nab2 G A 10: 127,664,924 Q100* probably null Het
Nfat5 T A 8: 107,355,651 probably null Het
Nqo1 T C 8: 107,388,868 H259R probably damaging Het
Nrd1 T A 4: 109,013,747 D190E probably benign Het
Olfr1030 T A 2: 85,984,804 probably benign Het
Osmr G A 15: 6,815,795 P830L probably damaging Het
Parp14 G A 16: 35,841,457 P1403S probably benign Het
Pde11a T A 2: 76,017,850 M878L probably benign Het
Pik3ap1 T C 19: 41,385,016 probably benign Het
Pla2g3 T C 11: 3,491,916 L360P probably damaging Het
Plxnc1 A G 10: 94,943,848 V244A probably benign Het
Pramef25 C T 4: 143,950,899 A37T possibly damaging Het
Ptpra T C 2: 130,503,502 V8A probably benign Het
Rbbp5 T C 1: 132,494,340 V199A probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rp1 A G 1: 4,352,836 V7A possibly damaging Het
Sdk2 T C 11: 113,830,063 T1347A probably benign Het
Sgo2a T A 1: 58,016,959 H767Q probably benign Het
Sis G A 3: 72,913,192 P1413L possibly damaging Het
Slc22a5 G T 11: 53,876,020 A214E probably damaging Het
Snx13 G T 12: 35,047,319 probably benign Het
Sun5 T A 2: 153,858,443 I295F probably damaging Het
Themis3 C T 17: 66,593,209 A55T probably damaging Het
Tmem255b T C 8: 13,455,138 Y148H probably benign Het
Tmem74b A G 2: 151,706,719 E122G probably damaging Het
Top3b T C 16: 16,892,892 V862A probably damaging Het
Trim35 A T 14: 66,308,750 D322V probably damaging Het
Trpm2 A G 10: 77,917,713 F1319S probably benign Het
Ttn T A 2: 76,954,676 R756S probably benign Het
Vmn2r108 A T 17: 20,463,006 N645K possibly damaging Het
Vmn2r73 A G 7: 85,872,667 S155P possibly damaging Het
Vstm4 G A 14: 32,863,670 A65T probably benign Het
Other mutations in Ipo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0268:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0277:Ipo4 UTSW 14 55632115 missense probably benign 0.03
R0344:Ipo4 UTSW 14 55625942 missense possibly damaging 0.92
R0467:Ipo4 UTSW 14 55635526 start codon destroyed probably null
R1167:Ipo4 UTSW 14 55635020 missense probably damaging 1.00
R1217:Ipo4 UTSW 14 55634359 missense probably damaging 0.98
R1804:Ipo4 UTSW 14 55629456 missense probably damaging 1.00
R2270:Ipo4 UTSW 14 55634100 missense probably damaging 1.00
R3551:Ipo4 UTSW 14 55633103 missense probably benign 0.10
R4561:Ipo4 UTSW 14 55630089 splice site probably benign
R4801:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4802:Ipo4 UTSW 14 55631214 missense probably damaging 1.00
R4804:Ipo4 UTSW 14 55630856 missense possibly damaging 0.80
R5384:Ipo4 UTSW 14 55626196 missense probably benign 0.28
R5493:Ipo4 UTSW 14 55630870 missense probably benign 0.00
R5527:Ipo4 UTSW 14 55632050 unclassified probably null
R5631:Ipo4 UTSW 14 55632069 missense probably damaging 1.00
R5631:Ipo4 UTSW 14 55633381 missense probably benign 0.08
R5788:Ipo4 UTSW 14 55628820 missense probably benign 0.02
R5929:Ipo4 UTSW 14 55631189 missense probably benign 0.03
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6031:Ipo4 UTSW 14 55632139 missense probably damaging 1.00
R6707:Ipo4 UTSW 14 55628904 missense possibly damaging 0.82
R7344:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7345:Ipo4 UTSW 14 55635531 missense probably benign 0.00
R7702:Ipo4 UTSW 14 55632330 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCATCATGGCCTGAAGTTC -3'
(R):5'- TGTCAGTTCAGACAAGCTCAC -3'

Sequencing Primer
(F):5'- CATCATGGCCTGAAGTTCCTGAG -3'
(R):5'- CAGGCTTCTGTCCTTGGTTTCAAC -3'
Posted On2017-06-26