Mutagenetix > Incidental Mutations

Incidental Mutation 'R6018:Trim35'

478741

Institutional Source

Beutler Lab

Gene Symbol

Trim35

Ensembl Gene

ENSMUSG00000022043

Gene Name

tripartite motif-containing 35

Synonyms

Hls5, Mair, A430106H13Rik, 0710005M05Rik

MMRRC Submission

044192-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.102) question?

Stock #

R6018 (G1)

Quality Score

99.0078

Status

Not validated

Chromosome

Chromosomal Location

66297031-66311424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 66308750 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 322 (D322V)

Ref Sequence

ENSEMBL: ENSMUSP00000022623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022623]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022623
AA Change: D322V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: D322V

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	18	29	N/A	INTRINSIC
RING	36	75	6.89e-8	SMART
BBOX	111	152	1.27e-6	SMART
coiled coil region	219	267	N/A	INTRINSIC
PRY	316	367	4.41e-15	SMART
Pfam:SPRY	370	495	3.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121006

SMART Domains

Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
RING	30	69	6.89e-8	SMART
BBOX	105	146	1.27e-6	SMART
coiled coil region	212	260	N/A	INTRINSIC
low complexity region	330	343	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.3%
20x: 91.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700006A11Rik	A	T	3: 124,416,799	Y155N	probably damaging	Het
1700019A02Rik	C	T	1: 53,163,246		probably null	Het
2310022B05Rik	A	G	8: 124,639,114	F297L	probably benign	Het
Acbd3	T	C	1: 180,752,338	S516P	possibly damaging	Het
Agbl3	A	G	6: 34,799,255	N227S	probably damaging	Het
Ak6	C	T	13: 100,665,951	Q151*	probably null	Het
Ano4	A	G	10: 89,029,266	L297P	probably benign	Het
Anxa5	T	C	3: 36,450,658	T252A	probably benign	Het
Ap5s1	G	A	2: 131,212,995	W212*	probably null	Het
Arl9	A	G	5: 77,007,406	Q113R	probably damaging	Het
Atg2b	T	C	12: 105,661,171	H519R	probably damaging	Het
Atp1a2	A	G	1: 172,298,012		probably benign	Het
Atp2b1	G	A	10: 99,010,760	A808T	probably damaging	Het
Bckdhb	C	A	9: 84,069,184	T342K	probably benign	Het
Bdp1	T	C	13: 100,038,224	H1996R	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Ccdc180	A	G	4: 45,926,235	I1148M	probably damaging	Het
Csf3r	T	A	4: 126,043,621	M766K	probably benign	Het
Ctnnd1	T	A	2: 84,650,468		probably benign	Het
Cyp2c39	A	T	19: 39,510,992	N41I	probably damaging	Het
D2hgdh	G	T	1: 93,826,460	V52L	probably benign	Het
Dppa4	T	A	16: 48,289,127	Y77*	probably null	Het
Eif4enif1	T	C	11: 3,242,481	S770P	probably damaging	Het
Fbxl16	A	T	17: 25,817,735	D230V	probably damaging	Het
Gm4847	G	A	1: 166,643,448	A11V	probably damaging	Het
Gm9978	C	T	10: 78,487,081		noncoding transcript	Het
Gpatch8	A	G	11: 102,480,915	L599P	unknown	Het
Hdac4	A	G	1: 91,958,398	L254P	probably damaging	Het
Heatr1	A	G	13: 12,404,947	I384V	probably benign	Het
Heatr1	A	T	13: 12,406,058	Q410L	probably benign	Het
Hmcn2	A	G	2: 31,370,792	I1065V	probably benign	Het
Igkv6-14	A	G	6: 70,435,040	S87P	probably damaging	Het
Il2rb	G	T	15: 78,482,066	Q344K	possibly damaging	Het
Ipo4	A	G	14: 55,626,152		probably null	Het
Ipo9	A	G	1: 135,390,536		probably null	Het
Khdrbs1	T	C	4: 129,720,094	T374A	probably benign	Het
Lamc3	G	T	2: 31,905,712	G370W	probably damaging	Het
Lipn	T	A	19: 34,076,935	L191Q	probably damaging	Het
Lpl	T	C	8: 68,901,288	V427A	probably benign	Het
Magi3	T	C	3: 104,105,812	S120G	probably damaging	Het
Mgl2	T	C	11: 70,137,111	*382Q	probably null	Het
Nab2	G	A	10: 127,664,924	Q100*	probably null	Het
Nfat5	T	A	8: 107,355,651		probably null	Het
Nqo1	T	C	8: 107,388,868	H259R	probably damaging	Het
Nrd1	T	A	4: 109,013,747	D190E	probably benign	Het
Olfr1030	T	A	2: 85,984,804		probably benign	Het
Osmr	G	A	15: 6,815,795	P830L	probably damaging	Het
Parp14	G	A	16: 35,841,457	P1403S	probably benign	Het
Pde11a	T	A	2: 76,017,850	M878L	probably benign	Het
Pik3ap1	T	C	19: 41,385,016		probably benign	Het
Pla2g3	T	C	11: 3,491,916	L360P	probably damaging	Het
Plxnc1	A	G	10: 94,943,848	V244A	probably benign	Het
Pramef25	C	T	4: 143,950,899	A37T	possibly damaging	Het
Ptpra	T	C	2: 130,503,502	V8A	probably benign	Het
Rbbp5	T	C	1: 132,494,340	V199A	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
Rp1	A	G	1: 4,352,836	V7A	possibly damaging	Het
Sdk2	T	C	11: 113,830,063	T1347A	probably benign	Het
Sgo2a	T	A	1: 58,016,959	H767Q	probably benign	Het
Sis	G	A	3: 72,913,192	P1413L	possibly damaging	Het
Slc22a5	G	T	11: 53,876,020	A214E	probably damaging	Het
Snx13	G	T	12: 35,047,319		probably benign	Het
Sun5	T	A	2: 153,858,443	I295F	probably damaging	Het
Themis3	C	T	17: 66,593,209	A55T	probably damaging	Het
Tmem255b	T	C	8: 13,455,138	Y148H	probably benign	Het
Tmem74b	A	G	2: 151,706,719	E122G	probably damaging	Het
Top3b	T	C	16: 16,892,892	V862A	probably damaging	Het
Trpm2	A	G	10: 77,917,713	F1319S	probably benign	Het
Ttn	T	A	2: 76,954,676	R756S	probably benign	Het
Vmn2r108	A	T	17: 20,463,006	N645K	possibly damaging	Het
Vmn2r73	A	G	7: 85,872,667	S155P	possibly damaging	Het
Vstm4	G	A	14: 32,863,670	A65T	probably benign	Het

Other mutations in Trim35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01652:Trim35	APN	14	66308801	missense	probably damaging	1.00
IGL02398:Trim35	APN	14	66309248	missense	probably damaging	1.00
IGL03132:Trim35	APN	14	66309146	missense	probably damaging	1.00
R0759:Trim35	UTSW	14	66308787	missense	probably benign	0.02
R0799:Trim35	UTSW	14	66309201	missense	probably damaging	1.00
R0848:Trim35	UTSW	14	66309125	missense	probably benign	0.01
R1170:Trim35	UTSW	14	66308799	missense	probably benign	0.35
R1734:Trim35	UTSW	14	66309329	missense	probably damaging	0.99
R1751:Trim35	UTSW	14	66304168	missense	probably damaging	0.97
R1767:Trim35	UTSW	14	66304168	missense	probably damaging	0.97
R2259:Trim35	UTSW	14	66309262	nonsense	probably null
R3963:Trim35	UTSW	14	66304054	missense	probably damaging	1.00
R4572:Trim35	UTSW	14	66307873	missense	probably damaging	1.00
R5068:Trim35	UTSW	14	66308972	unclassified	probably benign
R5069:Trim35	UTSW	14	66308972	unclassified	probably benign
R5070:Trim35	UTSW	14	66308972	unclassified	probably benign
R5372:Trim35	UTSW	14	66297266	missense	possibly damaging	0.69
R5886:Trim35	UTSW	14	66304053	missense	possibly damaging	0.92
R5886:Trim35	UTSW	14	66304054	missense	probably damaging	1.00
R6165:Trim35	UTSW	14	66309205	missense	probably damaging	1.00
R6326:Trim35	UTSW	14	66303204	missense	possibly damaging	0.52
R6476:Trim35	UTSW	14	66308795	missense	probably damaging	1.00
R7084:Trim35	UTSW	14	66308822	missense	probably damaging	0.98
R7192:Trim35	UTSW	14	66297446	missense	probably damaging	1.00
R7350:Trim35	UTSW	14	66309205	missense	probably damaging	1.00
R7546:Trim35	UTSW	14	66303247	missense	probably benign	0.02
R7644:Trim35	UTSW	14	66297097	missense	unknown
R7916:Trim35	UTSW	14	66308860	missense	probably damaging	1.00
R8406:Trim35	UTSW	14	66297275	missense	possibly damaging	0.91
R8524:Trim35	UTSW	14	66307044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCCTGCCTTGGTTGGTTAAATG -3'
(R):5'- CATGGTAGCAGCTGTGTGAG -3'

Sequencing Primer
(F):5'- ATCCTGAGGTACTAGTGTTTAGGAC -3'
(R):5'- TGTGCATGTGCCTGCAC -3'

Posted On

2017-06-26