Incidental Mutation 'R6019:Gm21994'
ID478767
Institutional Source Beutler Lab
Gene Symbol Gm21994
Ensembl Gene ENSMUSG00000074735
Gene Namepredicted gene 21994
Synonyms
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.394) question?
Stock #R6019 (G1)
Quality Score147.008
Status Validated
Chromosome2
Chromosomal Location150254518-150255591 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 150255212 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 99 (H99L)
Ref Sequence ENSEMBL: ENSMUSP00000075719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063463] [ENSMUST00000109922]
Predicted Effect probably damaging
Transcript: ENSMUST00000063463
AA Change: H99L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075719
Gene: ENSMUSG00000074735
AA Change: H99L

DomainStartEndE-ValueType
ZnF_C2H2 1 18 2.7e2 SMART
ZnF_C2H2 53 73 2.75e1 SMART
ZnF_C2H2 77 99 6.42e-4 SMART
ZnF_C2H2 132 154 1.58e-3 SMART
ZnF_C2H2 160 182 1.12e-3 SMART
ZnF_C2H2 188 210 4.01e-5 SMART
ZnF_C2H2 216 238 3.16e-3 SMART
ZnF_C2H2 244 266 8.94e-3 SMART
ZnF_C2H2 272 294 9.58e-3 SMART
ZnF_C2H2 300 322 1.95e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109922
SMART Domains Protein: ENSMUSP00000105548
Gene: ENSMUSG00000079008

DomainStartEndE-ValueType
KRAB 4 66 9.26e-19 SMART
ZnF_C2H2 103 125 7.49e-5 SMART
ZnF_C2H2 131 151 9.46e0 SMART
ZnF_C2H2 159 181 5.9e-3 SMART
ZnF_C2H2 187 209 6.67e-2 SMART
ZnF_C2H2 215 237 4.87e-4 SMART
ZnF_C2H2 243 265 2.82e0 SMART
ZnF_C2H2 271 293 2.2e2 SMART
ZnF_C2H2 299 321 1.4e-4 SMART
ZnF_C2H2 327 349 1.6e-4 SMART
ZnF_C2H2 355 377 1.18e-2 SMART
ZnF_C2H2 383 405 1.38e-3 SMART
ZnF_C2H2 411 433 9.56e1 SMART
ZnF_C2H2 439 461 6.99e-5 SMART
ZnF_C2H2 467 489 2.99e-4 SMART
ZnF_C2H2 495 517 7.78e-3 SMART
ZnF_C2H2 523 545 1.04e-3 SMART
ZnF_C2H2 551 573 1.6e-4 SMART
ZnF_C2H2 579 601 1.18e-2 SMART
ZnF_C2H2 607 629 4.54e-4 SMART
ZnF_C2H2 635 657 4.24e-4 SMART
ZnF_C2H2 663 685 1.2e-3 SMART
ZnF_C2H2 691 713 8.47e-4 SMART
Meta Mutation Damage Score 0.9202 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Gm21994
AlleleSourceChrCoordTypePredicted EffectPPH Score
R6648_Gm21994_337 UTSW 2 150255177 missense probably benign 0.01
R0853:Gm21994 UTSW 2 150255478 missense probably benign 0.30
R5135:Gm21994 UTSW 2 150255490 nonsense probably null
R5161:Gm21994 UTSW 2 150255215 missense probably damaging 0.99
R5782:Gm21994 UTSW 2 150255518 missense probably benign 0.41
R6284:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6476:Gm21994 UTSW 2 150255326 missense probably benign 0.00
R6479:Gm21994 UTSW 2 150254591 missense probably damaging 0.99
R6648:Gm21994 UTSW 2 150255177 missense probably benign 0.01
R6736:Gm21994 UTSW 2 150255278 missense possibly damaging 0.95
R6963:Gm21994 UTSW 2 150255345 missense probably damaging 1.00
R7014:Gm21994 UTSW 2 150255262 nonsense probably null
R7138:Gm21994 UTSW 2 150255452 missense probably damaging 1.00
R7625:Gm21994 UTSW 2 150254600 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAAAGGGTTTCTCTCCAGTATGTG -3'
(R):5'- TCAACTTGGGAAGAAAGCCTATG -3'

Sequencing Primer
(F):5'- TTCTCTCCAGTATGTGTTCTTTTATG -3'
(R):5'- GTGTCCAACATTGTGAAGCC -3'
Posted On2017-06-26