Incidental Mutation 'R6019:Hnrnpd'
ID478777
Institutional Source Beutler Lab
Gene Symbol Hnrnpd
Ensembl Gene ENSMUSG00000000568
Gene Nameheterogeneous nuclear ribonucleoprotein D
SynonymsAuf1, Hnrpd
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.742) question?
Stock #R6019 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location99955935-99978938 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 99967236 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 148 (S148P)
Ref Sequence ENSEMBL: ENSMUSP00000132735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019128] [ENSMUST00000072750] [ENSMUST00000112939] [ENSMUST00000164833] [ENSMUST00000168396] [ENSMUST00000170912] [ENSMUST00000171640] [ENSMUST00000171786] [ENSMUST00000172361]
Predicted Effect probably benign
Transcript: ENSMUST00000019128
AA Change: S148P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000019128
Gene: ENSMUSG00000000568
AA Change: S148P

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 1.3e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 289 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000072750
AA Change: S129P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072533
Gene: ENSMUSG00000000568
AA Change: S129P

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 270 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112939
AA Change: S129P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000108561
Gene: ENSMUSG00000000568
AA Change: S129P

DomainStartEndE-ValueType
low complexity region 7 66 N/A INTRINSIC
RRM 79 151 3.85e-25 SMART
RRM 164 236 7.76e-21 SMART
low complexity region 243 249 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
low complexity region 272 321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164833
SMART Domains Protein: ENSMUSP00000131785
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
Blast:RRM 1 31 3e-13 BLAST
PDB:1X0F|A 1 35 1e-17 PDB
SCOP:d1fj7a_ 1 40 4e-4 SMART
low complexity region 46 61 N/A INTRINSIC
low complexity region 67 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168396
SMART Domains Protein: ENSMUSP00000131859
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
Pfam:CBFNT 1 79 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170654
Predicted Effect probably benign
Transcript: ENSMUST00000170912
Predicted Effect unknown
Transcript: ENSMUST00000171106
AA Change: S57P
SMART Domains Protein: ENSMUSP00000131262
Gene: ENSMUSG00000000568
AA Change: S57P

DomainStartEndE-ValueType
RRM 8 80 3.85e-25 SMART
RRM 93 165 7.76e-21 SMART
low complexity region 172 178 N/A INTRINSIC
low complexity region 180 199 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171640
SMART Domains Protein: ENSMUSP00000127833
Gene: ENSMUSG00000000568

DomainStartEndE-ValueType
RRM 27 99 7.76e-21 SMART
low complexity region 106 112 N/A INTRINSIC
low complexity region 114 133 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171786
AA Change: S50P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125984
Gene: ENSMUSG00000000568
AA Change: S50P

DomainStartEndE-ValueType
RRM 1 72 8.44e-22 SMART
internal_repeat_1 86 107 2.75e-5 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000172361
AA Change: S148P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000132735
Gene: ENSMUSG00000000568
AA Change: S148P

DomainStartEndE-ValueType
Pfam:CBFNT 1 78 9.6e-16 PFAM
RRM 98 170 3.85e-25 SMART
RRM 183 255 7.76e-21 SMART
low complexity region 262 268 N/A INTRINSIC
low complexity region 270 285 N/A INTRINSIC
low complexity region 291 340 N/A INTRINSIC
Meta Mutation Damage Score 0.1109 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are nucleic acid binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. It localizes to both the nucleus and the cytoplasm. This protein is implicated in the regulation of mRNA stability. Alternative splicing of this gene results in four transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in fetal growth retardation and decreased body weight. Mice show increased susceptibility to bacterial infection and endotoxin shock. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Hnrnpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0066:Hnrnpd UTSW 5 99964701 missense probably damaging 1.00
R0066:Hnrnpd UTSW 5 99964701 missense probably damaging 1.00
R1022:Hnrnpd UTSW 5 99966157 makesense probably null
R1024:Hnrnpd UTSW 5 99966157 makesense probably null
R6502:Hnrnpd UTSW 5 99966166 missense probably damaging 1.00
R6785:Hnrnpd UTSW 5 99978424 missense probably benign 0.12
R6937:Hnrnpd UTSW 5 99963770 missense probably benign 0.08
R7080:Hnrnpd UTSW 5 99976533 critical splice donor site probably null
R7577:Hnrnpd UTSW 5 99967254 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTAGGAAGGCTGGCACATG -3'
(R):5'- TGGAACTTTAAACAGTAGGGTTTGG -3'

Sequencing Primer
(F):5'- TCAGGGTAGTCCTCAGCCATG -3'
(R):5'- TTGAAAAGAAGGTGTGTTACTGATG -3'
Posted On2017-06-26