Incidental Mutation 'R6019:Dspp'
ID478779
Institutional Source Beutler Lab
Gene Symbol Dspp
Ensembl Gene ENSMUSG00000053268
Gene Namedentin sialophosphoprotein
SynonymsDmp3, Dsp, Dpp
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6019 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location104170712-104180127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 104178039 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 756 (D756V)
Ref Sequence ENSEMBL: ENSMUSP00000108391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112771]
Predicted Effect unknown
Transcript: ENSMUST00000112771
AA Change: D756V
SMART Domains Protein: ENSMUSP00000108391
Gene: ENSMUSG00000053268
AA Change: D756V

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 52 67 N/A INTRINSIC
internal_repeat_1 82 245 2.01e-11 PROSPERO
low complexity region 247 268 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
internal_repeat_1 285 438 2.01e-11 PROSPERO
internal_repeat_2 286 369 2.15e-10 PROSPERO
internal_repeat_2 370 454 2.15e-10 PROSPERO
low complexity region 456 472 N/A INTRINSIC
low complexity region 481 944 N/A INTRINSIC
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: This gene encodes a member of the small integrin-binding ligand N-linked glycoprotein (SIBLING) family of proteins. The encoded preproprotein is secreted by odontoblasts and proteolytically processed to generate two principal proteins of the dentin extracellular matrix of the tooth, dentin sialoprotein and dentin phosphoprotein. These two protein products may play distinct but related roles in dentin mineralization. Mice lacking the encoded protein exhibit hypomineralization defects in dentin, similar to human dentinogenesis imperfecta. [provided by RefSeq, Feb 2016]
PHENOTYPE: Aging mice homozygous for a reporter/null allele display tooth abnormalities, including enlarged pulp cavities, a widened predentin zone, dentin hypomineralization, pulp exposure, and occasional brittle incisors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
Krt75 C A 15: 101,573,723 V37L probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Dspp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00973:Dspp APN 5 104176892 missense possibly damaging 0.95
IGL01096:Dspp APN 5 104175367 missense possibly damaging 0.92
IGL01317:Dspp APN 5 104174048 missense probably damaging 0.99
IGL02365:Dspp APN 5 104176061 missense probably damaging 1.00
IGL02387:Dspp APN 5 104175624 missense possibly damaging 0.82
IGL02406:Dspp APN 5 104177366 nonsense probably null
IGL02445:Dspp APN 5 104177097 missense probably damaging 0.99
IGL02481:Dspp APN 5 104175648 missense possibly damaging 0.94
IGL02536:Dspp APN 5 104175665 missense probably damaging 0.99
IGL02572:Dspp APN 5 104177069 missense probably damaging 0.99
IGL02677:Dspp APN 5 104175977 missense possibly damaging 0.78
IGL02709:Dspp APN 5 104177250 missense unknown
IGL02723:Dspp APN 5 104175175 missense probably benign 0.03
IGL02740:Dspp APN 5 104177238 nonsense probably null
IGL03274:Dspp APN 5 104174948 missense probably damaging 0.99
IGL03293:Dspp APN 5 104177561 missense unknown
FR4449:Dspp UTSW 5 104178388 small deletion probably benign
R0018:Dspp UTSW 5 104178230 missense unknown
R0125:Dspp UTSW 5 104178039 missense unknown
R0503:Dspp UTSW 5 104177256 missense unknown
R1709:Dspp UTSW 5 104175724 missense probably damaging 0.98
R1851:Dspp UTSW 5 104174085 critical splice donor site probably null
R2001:Dspp UTSW 5 104178559 missense unknown
R2002:Dspp UTSW 5 104178559 missense unknown
R2198:Dspp UTSW 5 104175701 missense probably benign 0.37
R2279:Dspp UTSW 5 104178384 missense unknown
R4026:Dspp UTSW 5 104177697 missense unknown
R4066:Dspp UTSW 5 104177194 missense unknown
R4632:Dspp UTSW 5 104177406 missense unknown
R4693:Dspp UTSW 5 104178062 missense unknown
R4841:Dspp UTSW 5 104177186 missense unknown
R4841:Dspp UTSW 5 104177187 missense unknown
R4917:Dspp UTSW 5 104177923 missense unknown
R5008:Dspp UTSW 5 104175573 missense possibly damaging 0.66
R5015:Dspp UTSW 5 104177060 missense possibly damaging 0.46
R5214:Dspp UTSW 5 104178498 missense unknown
R5359:Dspp UTSW 5 104175886 missense probably damaging 0.98
R5538:Dspp UTSW 5 104175230 nonsense probably null
R5703:Dspp UTSW 5 104177051 missense possibly damaging 0.82
R5887:Dspp UTSW 5 104175455 missense probably damaging 1.00
R5902:Dspp UTSW 5 104178111 missense unknown
R5992:Dspp UTSW 5 104178451 missense unknown
R6191:Dspp UTSW 5 104177348 missense unknown
R6362:Dspp UTSW 5 104176034 missense probably benign 0.19
R6736:Dspp UTSW 5 104178175 missense unknown
R6805:Dspp UTSW 5 104175850 missense probably benign 0.03
R7064:Dspp UTSW 5 104176938 missense possibly damaging 0.73
R7178:Dspp UTSW 5 104174066 missense probably benign 0.02
R7243:Dspp UTSW 5 104178361 small deletion probably benign
R7390:Dspp UTSW 5 104175686 missense probably damaging 0.98
R7454:Dspp UTSW 5 104175610 missense probably benign 0.01
R7585:Dspp UTSW 5 104175525 missense possibly damaging 0.90
R7662:Dspp UTSW 5 104177870 missense unknown
R7739:Dspp UTSW 5 104178146 missense unknown
R7755:Dspp UTSW 5 104178361 small deletion probably benign
R7805:Dspp UTSW 5 104175393 missense probably damaging 0.99
R7869:Dspp UTSW 5 104175665 missense probably damaging 0.99
R7952:Dspp UTSW 5 104175665 missense probably damaging 0.99
RF007:Dspp UTSW 5 104178361 small deletion probably benign
RF044:Dspp UTSW 5 104178424 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- AGTGACAGCAGTGACAGCAG -3'
(R):5'- ATCACTGCTGTCAGAACTGCT -3'

Sequencing Primer
(F):5'- CAGTGACAGCAGCAGCAGC -3'
(R):5'- GCTGTCAGAACTGCTATCCTTG -3'
Posted On2017-06-26