Mutagenetix > Incidental Mutation

Incidental Mutation 'R6019:Pole'

478781

Institutional Source

Beutler Lab

Gene Symbol

Pole

Ensembl Gene

ENSMUSG00000007080

Gene Name

polymerase (DNA directed), epsilon

Synonyms

pol-epsilon

MMRRC Submission

044193-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6019 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

110286306-110337474 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110324515 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1548 (P1548L)

Ref Sequence

ENSEMBL: ENSMUSP00000007296 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000007296]

AlphaFold

Q9WVF7

Predicted Effect

probably benign
Transcript: ENSMUST00000007296
AA Change: P1548L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: P1548L

Domain	Start	End	E-Value	Type
POLBc	267	870	9.42e-97	SMART
Blast:POLBc	903	970	1e-28	BLAST
Blast:POLBc	1014	1073	2e-22	BLAST
Blast:POLBc	1195	1266	7e-21	BLAST
low complexity region	1275	1294	N/A	INTRINSIC
Blast:DUF1744	1401	1430	2e-7	BLAST
DUF1744	1524	1924	1.9e-236	SMART
coiled coil region	1936	1963	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000120365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000152495

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000157097

Meta Mutation Damage Score

0.1278

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	C	T	16: 20,552,451	H436Y	possibly damaging	Het
Acad10	A	T	5: 121,634,801	H472Q	possibly damaging	Het
Ano8	G	A	8: 71,482,380	R393C	probably damaging	Het
Arhgap18	T	A	10: 26,860,650	V163E	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Cacng5	T	C	11: 107,884,388	M52V	probably benign	Het
Casz1	T	C	4: 148,947,038	C1249R	probably damaging	Het
Cenpj	C	T	14: 56,534,815	S1086N	probably benign	Het
Chil1	T	C	1: 134,189,572	F367S	probably benign	Het
Copg2	A	T	6: 30,810,933	I610N	possibly damaging	Het
Cpa6	T	C	1: 10,595,643	K57E	possibly damaging	Het
D5Ertd579e	C	T	5: 36,629,692	A111T	possibly damaging	Het
Dgat2	A	G	7: 99,154,631	M361T	probably benign	Het
Dnm3	G	T	1: 162,134,501	F46L	probably damaging	Het
Dph7	T	A	2: 24,963,540	C122*	probably null	Het
Dspp	A	T	5: 104,178,039	D756V	unknown	Het
Ep300	T	A	15: 81,641,382	M1469K	unknown	Het
Fsip2	T	C	2: 82,987,939	I4672T	possibly damaging	Het
Gapdh	A	T	6: 125,163,033	L67*	probably null	Het
Gm11639	T	C	11: 105,042,902		probably null	Het
Gm14025	T	C	2: 129,037,690	Q772R	probably benign	Het
Gm21994	T	A	2: 150,255,212	H99L	probably damaging	Het
Gm3259	G	A	5: 95,340,213	S2N	probably damaging	Het
Gm9495	A	T	8: 69,429,314	C337S	probably benign	Het
Gpr75	A	G	11: 30,891,640	R182G	probably benign	Het
Gsr	G	T	8: 33,693,807	A366S	probably damaging	Het
Gypc	A	G	18: 32,530,195	I33T	probably damaging	Het
Hapln1	A	G	13: 89,608,100	D341G	probably benign	Het
Hnrnpd	A	G	5: 99,967,236	S148P	probably benign	Het
Hydin	A	T	8: 110,566,620	T3450S	probably benign	Het
Kif20b	T	C	19: 34,950,464	V1002A	probably benign	Het
Kif5c	T	C	2: 49,735,509	V597A	probably benign	Het
Kntc1	A	G	5: 123,762,516	T226A	probably benign	Het
Krt75	C	A	15: 101,573,723	V37L	probably benign	Het
L3mbtl2	A	G	15: 81,686,942	I668V	probably benign	Het
Lrp1b	G	A	2: 41,302,970	A480V	probably damaging	Het
Lrp1b	T	A	2: 41,476,809	D485V	probably damaging	Het
Lrrc37a	T	C	11: 103,456,596	H3091R	unknown	Het
Msi1	A	G	5: 115,451,491	Y361C	probably damaging	Het
Mtus1	G	T	8: 41,083,040	N546K	probably benign	Het
Mup17	T	A	4: 61,593,699	T113S	probably benign	Het
Myh11	T	A	16: 14,206,074	D1479V	probably damaging	Het
Ncor1	C	T	11: 62,373,161	E198K	probably benign	Het
Nrde2	A	G	12: 100,132,242	V722A	probably benign	Het
Olfr206	C	T	16: 59,345,435	D89N	possibly damaging	Het
Olfr564	C	T	7: 102,804,284	R269*	probably null	Het
Olfr61	T	C	7: 140,638,012	F104L	probably benign	Het
Otog	A	G	7: 46,288,950	M2028V	probably benign	Het
Paox	T	A	7: 140,131,742	V169E	probably damaging	Het
Pcsk9	T	G	4: 106,456,876	D174A	probably benign	Het
Pde4b	A	G	4: 102,570,769	E41G	possibly damaging	Het
Pip4k2c	A	G	10: 127,199,074	I419T	probably damaging	Het
Plekhg3	G	T	12: 76,577,941	E1186*	probably null	Het
Polq	A	G	16: 37,061,764	E1430G	probably damaging	Het
Ptgr2	T	C	12: 84,298,146	S98P	probably damaging	Het
Ralgapa1	A	G	12: 55,684,042	Y1903H	possibly damaging	Het
Rasgrp1	T	C	2: 117,291,895	D338G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnase13	C	T	14: 51,922,403	C93Y	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
S100z	T	A	13: 95,477,426	M59L	probably benign	Het
Ska1	T	A	18: 74,199,921	D142V	probably benign	Het
Slc16a3	T	C	11: 120,957,105		probably null	Het
Snd1	T	C	6: 28,880,234	V669A	probably benign	Het
Snrpd3	A	T	10: 75,532,195	T49S	probably damaging	Het
Sort1	T	C	3: 108,357,233	L856P	possibly damaging	Het
Srek1ip1	T	A	13: 104,834,322		probably null	Het
Ssrp1	T	C	2: 85,045,452	S552P	probably damaging	Het
Stab2	A	G	10: 87,003,022	V60A	probably benign	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tll1	A	C	8: 64,041,491	H743Q	possibly damaging	Het
Tpo	G	T	12: 30,094,981	R590S	possibly damaging	Het
Trbv12-1	A	T	6: 41,113,846	T51S	probably benign	Het
Trbv30	C	T	6: 41,281,774	A40V	probably benign	Het
Tulp4	T	A	17: 6,233,215	V1173E	possibly damaging	Het
Upk1a	A	T	7: 30,612,385		probably null	Het
Vmn1r199	A	G	13: 22,382,599	D21G	possibly damaging	Het
Vmn2r7	T	C	3: 64,716,222	T317A	probably damaging	Het
Wdfy3	A	G	5: 101,849,423	V3112A	probably damaging	Het
Zbtb8os	T	C	4: 129,340,749	V40A	possibly damaging	Het
Zwint	A	G	10: 72,656,853	K108E	possibly damaging	Het

Other mutations in Pole

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Pole	APN	5	110303565	splice site	probably benign
IGL00475:Pole	APN	5	110291096	nonsense	probably null
IGL00837:Pole	APN	5	110302009	missense	possibly damaging	0.91
IGL00976:Pole	APN	5	110323572	missense	probably benign	0.00
IGL01081:Pole	APN	5	110337240	missense	possibly damaging	0.92
IGL01503:Pole	APN	5	110303884	missense	probably damaging	1.00
IGL01640:Pole	APN	5	110298266	missense	probably null	0.08
IGL01987:Pole	APN	5	110337232	missense	probably benign	0.01
IGL02429:Pole	APN	5	110299800	missense	probably benign
IGL02733:Pole	APN	5	110312728	splice site	probably benign
IGL03102:Pole	APN	5	110297073	missense	probably damaging	1.00
IGL03157:Pole	APN	5	110293753	missense	probably benign
IGL03186:Pole	APN	5	110299920	critical splice donor site	probably null
IGL03271:Pole	APN	5	110318319	missense	probably benign
IGL03351:Pole	APN	5	110301998	splice site	probably benign
IGL03408:Pole	APN	5	110294560	missense	probably damaging	1.00
IGL03410:Pole	APN	5	110324559	missense	probably benign
ANU74:Pole	UTSW	5	110289370	missense	probably benign	0.44
PIT4495001:Pole	UTSW	5	110303914	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0053:Pole	UTSW	5	110293340	missense	probably damaging	1.00
R0124:Pole	UTSW	5	110303992	missense	probably damaging	0.96
R0145:Pole	UTSW	5	110324425	missense	probably damaging	0.99
R0523:Pole	UTSW	5	110303593	missense	probably damaging	0.96
R0590:Pole	UTSW	5	110317926	missense	probably benign
R0625:Pole	UTSW	5	110325550	missense	possibly damaging	0.50
R0707:Pole	UTSW	5	110298988	missense	probably damaging	1.00
R1160:Pole	UTSW	5	110295253	missense	possibly damaging	0.85
R1320:Pole	UTSW	5	110309129	frame shift	probably null
R1384:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1626:Pole	UTSW	5	110293369	missense	probably benign	0.25
R1643:Pole	UTSW	5	110317845	missense	probably damaging	1.00
R1655:Pole	UTSW	5	110335922	missense	probably damaging	1.00
R1668:Pole	UTSW	5	110297369	missense	probably damaging	1.00
R1783:Pole	UTSW	5	110297430	missense	probably damaging	1.00
R1843:Pole	UTSW	5	110330835	critical splice donor site	probably null
R1853:Pole	UTSW	5	110306853	missense	possibly damaging	0.95
R1867:Pole	UTSW	5	110334197	missense	probably benign	0.08
R1874:Pole	UTSW	5	110323664	missense	possibly damaging	0.81
R1891:Pole	UTSW	5	110332542	missense	probably damaging	1.00
R1928:Pole	UTSW	5	110327778	missense	probably benign
R2073:Pole	UTSW	5	110325551	missense	probably damaging	0.99
R2341:Pole	UTSW	5	110330963	missense	possibly damaging	0.67
R2448:Pole	UTSW	5	110297092	missense	probably damaging	1.00
R2504:Pole	UTSW	5	110290502	splice site	probably null
R3053:Pole	UTSW	5	110289795	missense	probably damaging	1.00
R3892:Pole	UTSW	5	110336439	missense	probably damaging	1.00
R3964:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R3965:Pole	UTSW	5	110312782	missense	probably damaging	1.00
R4374:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4376:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4377:Pole	UTSW	5	110337205	missense	possibly damaging	0.89
R4520:Pole	UTSW	5	110297924	missense	probably damaging	1.00
R4670:Pole	UTSW	5	110306387	missense	probably benign	0.01
R4778:Pole	UTSW	5	110330832	missense	probably benign	0.00
R4887:Pole	UTSW	5	110324753	missense	probably damaging	0.99
R4898:Pole	UTSW	5	110290224	critical splice acceptor site	probably null
R5184:Pole	UTSW	5	110294934	missense	possibly damaging	0.91
R5359:Pole	UTSW	5	110332488	missense	probably benign	0.03
R5483:Pole	UTSW	5	110294568	missense	probably damaging	1.00
R5529:Pole	UTSW	5	110332466	missense	probably benign	0.20
R5576:Pole	UTSW	5	110312065	nonsense	probably null
R5817:Pole	UTSW	5	110312972	missense	probably damaging	1.00
R5877:Pole	UTSW	5	110332463	missense	probably benign
R5956:Pole	UTSW	5	110337287	unclassified	probably benign
R5990:Pole	UTSW	5	110302144	missense	probably damaging	1.00
R6019:Pole	UTSW	5	110324514	missense	probably benign	0.01
R6093:Pole	UTSW	5	110312090	missense	probably benign	0.01
R6376:Pole	UTSW	5	110336374	missense	probably damaging	0.99
R6494:Pole	UTSW	5	110324722	missense	possibly damaging	0.86
R6535:Pole	UTSW	5	110324807	missense	probably damaging	1.00
R6723:Pole	UTSW	5	110323616	missense	probably benign	0.11
R6757:Pole	UTSW	5	110303610	missense	probably damaging	1.00
R6930:Pole	UTSW	5	110293290	missense	probably benign	0.01
R6988:Pole	UTSW	5	110329583	missense	probably damaging	0.97
R6992:Pole	UTSW	5	110332499	missense	probably damaging	0.99
R7067:Pole	UTSW	5	110334218	missense	probably damaging	1.00
R7097:Pole	UTSW	5	110325102	splice site	probably null
R7122:Pole	UTSW	5	110325102	splice site	probably null
R7202:Pole	UTSW	5	110297107	missense	possibly damaging	0.94
R7340:Pole	UTSW	5	110334464	missense	probably benign	0.06
R7345:Pole	UTSW	5	110303903	missense	possibly damaging	0.82
R7509:Pole	UTSW	5	110330705	start gained	probably benign
R7557:Pole	UTSW	5	110312994	missense	probably damaging	1.00
R7740:Pole	UTSW	5	110331041	missense	probably benign	0.00
R7792:Pole	UTSW	5	110297466	splice site	probably null
R7832:Pole	UTSW	5	110317797	missense	probably benign	0.00
R7849:Pole	UTSW	5	110332548	missense	probably benign	0.04
R7852:Pole	UTSW	5	110306829	missense	probably damaging	1.00
R7960:Pole	UTSW	5	110289861	missense	possibly damaging	0.81
R8001:Pole	UTSW	5	110312734	missense	probably damaging	1.00
R8266:Pole	UTSW	5	110294920	missense	probably damaging	1.00
R8510:Pole	UTSW	5	110334446	missense	probably damaging	0.99
R8793:Pole	UTSW	5	110297748	missense	probably damaging	1.00
R8835:Pole	UTSW	5	110306909	missense	probably damaging	1.00
R8863:Pole	UTSW	5	110289367	missense	possibly damaging	0.94
R8929:Pole	UTSW	5	110297788	missense	probably damaging	0.98
R8968:Pole	UTSW	5	110312083	missense	possibly damaging	0.78
R8992:Pole	UTSW	5	110323622	missense	possibly damaging	0.88
R9018:Pole	UTSW	5	110289809	missense	probably benign	0.37
R9177:Pole	UTSW	5	110332422	missense	probably benign	0.04
R9250:Pole	UTSW	5	110299821	missense	possibly damaging	0.88
R9262:Pole	UTSW	5	110325556	missense	probably damaging	0.99
R9262:Pole	UTSW	5	110325557	missense	probably damaging	1.00
R9367:Pole	UTSW	5	110297089	missense	probably damaging	0.99
R9383:Pole	UTSW	5	110291026	missense	possibly damaging	0.61
X0064:Pole	UTSW	5	110317904	nonsense	probably null
Y5377:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Y5380:Pole	UTSW	5	110294891	critical splice acceptor site	probably null
Z1088:Pole	UTSW	5	110327865	missense	possibly damaging	0.66
Z1177:Pole	UTSW	5	110297009	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TATGGGGAAGAAAGATACTCCTCTTG -3'
(R):5'- ACTGGACAGCGATGAGTGTG -3'

Sequencing Primer
(F):5'- GAAAGATACTCCTCTTGCCATTCAG -3'
(R):5'- ATGAGTGTGGGCCCTCG -3'

Posted On

2017-06-26