Mutagenetix > Incidental Mutations

Incidental Mutation 'R6019:Upk1a'

478790

Institutional Source

Beutler Lab

Gene Symbol

Upk1a

Ensembl Gene

ENSMUSG00000006313

Gene Name

uroplakin 1A

Synonyms

1110031P12Rik, Upk1, Tspan21

MMRRC Submission

044193-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.233) question?

Stock #

R6019 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

30603092-30612847 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 30612385 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000006476 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000006476] [ENSMUST00000075738] [ENSMUST00000208838]

Predicted Effect

probably null
Transcript: ENSMUST00000006476

SMART Domains

Protein: ENSMUSP00000006476
Gene: ENSMUSG00000006313

Domain	Start	End	E-Value	Type
Pfam:Tetraspannin	14	257	1.8e-27	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000075738

SMART Domains

Protein: ENSMUSP00000075150
Gene: ENSMUSG00000036751

Domain	Start	End	E-Value	Type
Pfam:COX6B	19	83	1.9e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000208352

Predicted Effect

probably benign
Transcript: ENSMUST00000208838

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.2%
20x: 91.1%

Validation Efficiency

96% (81/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The protein may also play a role in tumor suppression. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 83 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	C	T	16: 20,552,451	H436Y	possibly damaging	Het
Acad10	A	T	5: 121,634,801	H472Q	possibly damaging	Het
Ano8	G	A	8: 71,482,380	R393C	probably damaging	Het
Arhgap18	T	A	10: 26,860,650	V163E	probably damaging	Het
AW209491	C	T	13: 14,637,780	A406V	probably benign	Het
Brix1	C	T	15: 10,476,589	R267H	probably benign	Het
Cacng5	T	C	11: 107,884,388	M52V	probably benign	Het
Casz1	T	C	4: 148,947,038	C1249R	probably damaging	Het
Cenpj	C	T	14: 56,534,815	S1086N	probably benign	Het
Chil1	T	C	1: 134,189,572	F367S	probably benign	Het
Copg2	A	T	6: 30,810,933	I610N	possibly damaging	Het
Cpa6	T	C	1: 10,595,643	K57E	possibly damaging	Het
D5Ertd579e	C	T	5: 36,629,692	A111T	possibly damaging	Het
Dgat2	A	G	7: 99,154,631	M361T	probably benign	Het
Dnm3	G	T	1: 162,134,501	F46L	probably damaging	Het
Dph7	T	A	2: 24,963,540	C122*	probably null	Het
Dspp	A	T	5: 104,178,039	D756V	unknown	Het
Ep300	T	A	15: 81,641,382	M1469K	unknown	Het
Fsip2	T	C	2: 82,987,939	I4672T	possibly damaging	Het
Gapdh	A	T	6: 125,163,033	L67*	probably null	Het
Gm11639	T	C	11: 105,042,902		probably null	Het
Gm14025	T	C	2: 129,037,690	Q772R	probably benign	Het
Gm21994	T	A	2: 150,255,212	H99L	probably damaging	Het
Gm3259	G	A	5: 95,340,213	S2N	probably damaging	Het
Gm9495	A	T	8: 69,429,314	C337S	probably benign	Het
Gpr75	A	G	11: 30,891,640	R182G	probably benign	Het
Gsr	G	T	8: 33,693,807	A366S	probably damaging	Het
Gypc	A	G	18: 32,530,195	I33T	probably damaging	Het
Hapln1	A	G	13: 89,608,100	D341G	probably benign	Het
Hnrnpd	A	G	5: 99,967,236	S148P	probably benign	Het
Hydin	A	T	8: 110,566,620	T3450S	probably benign	Het
Kif20b	T	C	19: 34,950,464	V1002A	probably benign	Het
Kif5c	T	C	2: 49,735,509	V597A	probably benign	Het
Kntc1	A	G	5: 123,762,516	T226A	probably benign	Het
Krt75	C	A	15: 101,573,723	V37L	probably benign	Het
L3mbtl2	A	G	15: 81,686,942	I668V	probably benign	Het
Lrp1b	G	A	2: 41,302,970	A480V	probably damaging	Het
Lrp1b	T	A	2: 41,476,809	D485V	probably damaging	Het
Lrrc37a	T	C	11: 103,456,596	H3091R	unknown	Het
Msi1	A	G	5: 115,451,491	Y361C	probably damaging	Het
Mtus1	G	T	8: 41,083,040	N546K	probably benign	Het
Mup17	T	A	4: 61,593,699	T113S	probably benign	Het
Myh11	T	A	16: 14,206,074	D1479V	probably damaging	Het
Ncor1	C	T	11: 62,373,161	E198K	probably benign	Het
Nrde2	A	G	12: 100,132,242	V722A	probably benign	Het
Olfr206	C	T	16: 59,345,435	D89N	possibly damaging	Het
Olfr564	C	T	7: 102,804,284	R269*	probably null	Het
Olfr61	T	C	7: 140,638,012	F104L	probably benign	Het
Otog	A	G	7: 46,288,950	M2028V	probably benign	Het
Paox	T	A	7: 140,131,742	V169E	probably damaging	Het
Pcsk9	T	G	4: 106,456,876	D174A	probably benign	Het
Pde4b	A	G	4: 102,570,769	E41G	possibly damaging	Het
Pip4k2c	A	G	10: 127,199,074	I419T	probably damaging	Het
Plekhg3	G	T	12: 76,577,941	E1186*	probably null	Het
Pole	C	A	5: 110,324,514	P1548T	probably benign	Het
Pole	C	T	5: 110,324,515	P1548L	probably benign	Het
Polq	A	G	16: 37,061,764	E1430G	probably damaging	Het
Ptgr2	T	C	12: 84,298,146	S98P	probably damaging	Het
Ralgapa1	A	G	12: 55,684,042	Y1903H	possibly damaging	Het
Rasgrp1	T	C	2: 117,291,895	D338G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnase13	C	T	14: 51,922,403	C93Y	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
S100z	T	A	13: 95,477,426	M59L	probably benign	Het
Ska1	T	A	18: 74,199,921	D142V	probably benign	Het
Slc16a3	T	C	11: 120,957,105		probably null	Het
Snd1	T	C	6: 28,880,234	V669A	probably benign	Het
Snrpd3	A	T	10: 75,532,195	T49S	probably damaging	Het
Sort1	T	C	3: 108,357,233	L856P	possibly damaging	Het
Srek1ip1	T	A	13: 104,834,322		probably null	Het
Ssrp1	T	C	2: 85,045,452	S552P	probably damaging	Het
Stab2	A	G	10: 87,003,022	V60A	probably benign	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tll1	A	C	8: 64,041,491	H743Q	possibly damaging	Het
Tpo	G	T	12: 30,094,981	R590S	possibly damaging	Het
Trbv12-1	A	T	6: 41,113,846	T51S	probably benign	Het
Trbv30	C	T	6: 41,281,774	A40V	probably benign	Het
Tulp4	T	A	17: 6,233,215	V1173E	possibly damaging	Het
Vmn1r199	A	G	13: 22,382,599	D21G	possibly damaging	Het
Vmn2r7	T	C	3: 64,716,222	T317A	probably damaging	Het
Wdfy3	A	G	5: 101,849,423	V3112A	probably damaging	Het
Zbtb8os	T	C	4: 129,340,749	V40A	possibly damaging	Het
Zwint	A	G	10: 72,656,853	K108E	possibly damaging	Het

Other mutations in Upk1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02901:Upk1a	APN	7	30603779	missense	possibly damaging	0.94
IGL03250:Upk1a	APN	7	30606978	missense	possibly damaging	0.57
R0123:Upk1a	UTSW	7	30612394	missense	possibly damaging	0.92
R1480:Upk1a	UTSW	7	30606886	missense	probably benign
R1566:Upk1a	UTSW	7	30609720	missense	possibly damaging	0.71
R4669:Upk1a	UTSW	7	30605129	missense	probably benign	0.22
R7113:Upk1a	UTSW	7	30609811	missense	probably damaging	0.98
R7434:Upk1a	UTSW	7	30607192	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCCCTGAGTTGTGGATGAATC -3'
(R):5'- TGGACTCTGGGCATATGGAC -3'

Sequencing Primer
(F):5'- GTTGTGGATGAATCTACATGATCCAC -3'
(R):5'- ACTCTGGGCATATGGACACCAG -3'

Posted On

2017-06-26