Incidental Mutation 'R6019:Krt75'
ID478829
Institutional Source Beutler Lab
Gene Symbol Krt75
Ensembl Gene ENSMUSG00000022986
Gene Namekeratin 75
SynonymsKrt2-6hf, 4732468K03Rik, K6hf, Krtcap1
MMRRC Submission 044193-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R6019 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location101563345-101573904 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 101573723 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 37 (V37L)
Ref Sequence ENSEMBL: ENSMUSP00000036246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042957]
Predicted Effect probably benign
Transcript: ENSMUST00000042957
AA Change: V37L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000036246
Gene: ENSMUSG00000022986
AA Change: V37L

DomainStartEndE-ValueType
Pfam:Keratin_2_head 16 146 1e-32 PFAM
Filament 149 462 1.68e-178 SMART
low complexity region 468 527 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196179
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.2%
  • 20x: 91.1%
Validation Efficiency 96% (81/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the type II keratin family clustered on the long arm of chromosome 12. Type I and type II keratins heteropolymerize to form intermediate-sized filaments in the cytoplasm of epithelial cells. This gene is expressed in the companion layer, upper germinative matrix region of the hair follicle, and medulla of the hair shaft. The encoded protein plays an essential role in hair and nail formation. Variations in this gene have been associated with the hair disorders pseudofolliculitis barbae (PFB) and loose anagen hair syndrome (LAHS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a knock-in mutation that results in the deletion of the highly conserved asparagine residue (N159) in the helix initiation peptide of this gene develop hair shaft and nail abnormalities resembling pachyonychia congenita. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf3 C T 16: 20,552,451 H436Y possibly damaging Het
Acad10 A T 5: 121,634,801 H472Q possibly damaging Het
Ano8 G A 8: 71,482,380 R393C probably damaging Het
Arhgap18 T A 10: 26,860,650 V163E probably damaging Het
AW209491 C T 13: 14,637,780 A406V probably benign Het
Brix1 C T 15: 10,476,589 R267H probably benign Het
Cacng5 T C 11: 107,884,388 M52V probably benign Het
Casz1 T C 4: 148,947,038 C1249R probably damaging Het
Cenpj C T 14: 56,534,815 S1086N probably benign Het
Chil1 T C 1: 134,189,572 F367S probably benign Het
Copg2 A T 6: 30,810,933 I610N possibly damaging Het
Cpa6 T C 1: 10,595,643 K57E possibly damaging Het
D5Ertd579e C T 5: 36,629,692 A111T possibly damaging Het
Dgat2 A G 7: 99,154,631 M361T probably benign Het
Dnm3 G T 1: 162,134,501 F46L probably damaging Het
Dph7 T A 2: 24,963,540 C122* probably null Het
Dspp A T 5: 104,178,039 D756V unknown Het
Ep300 T A 15: 81,641,382 M1469K unknown Het
Fsip2 T C 2: 82,987,939 I4672T possibly damaging Het
Gapdh A T 6: 125,163,033 L67* probably null Het
Gm11639 T C 11: 105,042,902 probably null Het
Gm14025 T C 2: 129,037,690 Q772R probably benign Het
Gm21994 T A 2: 150,255,212 H99L probably damaging Het
Gm3259 G A 5: 95,340,213 S2N probably damaging Het
Gm9495 A T 8: 69,429,314 C337S probably benign Het
Gpr75 A G 11: 30,891,640 R182G probably benign Het
Gsr G T 8: 33,693,807 A366S probably damaging Het
Gypc A G 18: 32,530,195 I33T probably damaging Het
Hapln1 A G 13: 89,608,100 D341G probably benign Het
Hnrnpd A G 5: 99,967,236 S148P probably benign Het
Hydin A T 8: 110,566,620 T3450S probably benign Het
Kif20b T C 19: 34,950,464 V1002A probably benign Het
Kif5c T C 2: 49,735,509 V597A probably benign Het
Kntc1 A G 5: 123,762,516 T226A probably benign Het
L3mbtl2 A G 15: 81,686,942 I668V probably benign Het
Lrp1b G A 2: 41,302,970 A480V probably damaging Het
Lrp1b T A 2: 41,476,809 D485V probably damaging Het
Lrrc37a T C 11: 103,456,596 H3091R unknown Het
Msi1 A G 5: 115,451,491 Y361C probably damaging Het
Mtus1 G T 8: 41,083,040 N546K probably benign Het
Mup17 T A 4: 61,593,699 T113S probably benign Het
Myh11 T A 16: 14,206,074 D1479V probably damaging Het
Ncor1 C T 11: 62,373,161 E198K probably benign Het
Nrde2 A G 12: 100,132,242 V722A probably benign Het
Olfr206 C T 16: 59,345,435 D89N possibly damaging Het
Olfr564 C T 7: 102,804,284 R269* probably null Het
Olfr61 T C 7: 140,638,012 F104L probably benign Het
Otog A G 7: 46,288,950 M2028V probably benign Het
Paox T A 7: 140,131,742 V169E probably damaging Het
Pcsk9 T G 4: 106,456,876 D174A probably benign Het
Pde4b A G 4: 102,570,769 E41G possibly damaging Het
Pip4k2c A G 10: 127,199,074 I419T probably damaging Het
Plekhg3 G T 12: 76,577,941 E1186* probably null Het
Pole C A 5: 110,324,514 P1548T probably benign Het
Pole C T 5: 110,324,515 P1548L probably benign Het
Polq A G 16: 37,061,764 E1430G probably damaging Het
Ptgr2 T C 12: 84,298,146 S98P probably damaging Het
Ralgapa1 A G 12: 55,684,042 Y1903H possibly damaging Het
Rasgrp1 T C 2: 117,291,895 D338G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnase13 C T 14: 51,922,403 C93Y probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
S100z T A 13: 95,477,426 M59L probably benign Het
Ska1 T A 18: 74,199,921 D142V probably benign Het
Slc16a3 T C 11: 120,957,105 probably null Het
Snd1 T C 6: 28,880,234 V669A probably benign Het
Snrpd3 A T 10: 75,532,195 T49S probably damaging Het
Sort1 T C 3: 108,357,233 L856P possibly damaging Het
Srek1ip1 T A 13: 104,834,322 probably null Het
Ssrp1 T C 2: 85,045,452 S552P probably damaging Het
Stab2 A G 10: 87,003,022 V60A probably benign Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tll1 A C 8: 64,041,491 H743Q possibly damaging Het
Tpo G T 12: 30,094,981 R590S possibly damaging Het
Trbv12-1 A T 6: 41,113,846 T51S probably benign Het
Trbv30 C T 6: 41,281,774 A40V probably benign Het
Tulp4 T A 17: 6,233,215 V1173E possibly damaging Het
Upk1a A T 7: 30,612,385 probably null Het
Vmn1r199 A G 13: 22,382,599 D21G possibly damaging Het
Vmn2r7 T C 3: 64,716,222 T317A probably damaging Het
Wdfy3 A G 5: 101,849,423 V3112A probably damaging Het
Zbtb8os T C 4: 129,340,749 V40A possibly damaging Het
Zwint A G 10: 72,656,853 K108E possibly damaging Het
Other mutations in Krt75
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Krt75 APN 15 101572646 missense probably benign
IGL01406:Krt75 APN 15 101568025 missense probably damaging 1.00
IGL01783:Krt75 APN 15 101564929 missense probably benign 0.01
IGL01911:Krt75 APN 15 101568102 missense probably damaging 1.00
IGL01945:Krt75 APN 15 101570164 missense possibly damaging 0.56
IGL02178:Krt75 APN 15 101572791 missense probably benign 0.00
IGL02832:Krt75 APN 15 101568073 missense probably benign 0.02
IGL03173:Krt75 APN 15 101572727 missense probably damaging 1.00
IGL03276:Krt75 APN 15 101568376 missense probably damaging 0.98
R0482:Krt75 UTSW 15 101570311 missense probably benign 0.22
R0595:Krt75 UTSW 15 101568354 missense probably damaging 1.00
R0626:Krt75 UTSW 15 101573590 missense probably benign 0.05
R1495:Krt75 UTSW 15 101573873 start gained probably benign
R1886:Krt75 UTSW 15 101571097 missense probably damaging 0.97
R1906:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R1907:Krt75 UTSW 15 101573366 missense possibly damaging 0.66
R2055:Krt75 UTSW 15 101572761 missense probably benign 0.08
R2504:Krt75 UTSW 15 101568031 missense probably benign 0.27
R2930:Krt75 UTSW 15 101568031 missense probably benign 0.27
R3788:Krt75 UTSW 15 101573521 missense possibly damaging 0.94
R4494:Krt75 UTSW 15 101571701 nonsense probably null
R4803:Krt75 UTSW 15 101568072 missense probably benign 0.00
R4868:Krt75 UTSW 15 101568121 missense probably damaging 1.00
R4906:Krt75 UTSW 15 101570239 missense probably damaging 1.00
R4969:Krt75 UTSW 15 101573813 missense probably benign
R5069:Krt75 UTSW 15 101566238 critical splice donor site probably null
R5446:Krt75 UTSW 15 101571067 missense probably null 0.22
R6739:Krt75 UTSW 15 101571068 missense probably benign 0.00
R6835:Krt75 UTSW 15 101571037 missense probably benign 0.16
R7167:Krt75 UTSW 15 101568315 missense possibly damaging 0.90
R7622:Krt75 UTSW 15 101570272 missense probably damaging 1.00
X0022:Krt75 UTSW 15 101570213 missense possibly damaging 0.94
Z1088:Krt75 UTSW 15 101573665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACTTCCTGAATGCCTCCAGAG -3'
(R):5'- AGTCTAAGGACCTGCACCTC -3'

Sequencing Primer
(F):5'- CCTCCAGAGGGACAGACAG -3'
(R):5'- ACCTCCCTAACCGCCTGG -3'
Posted On2017-06-26