Incidental Mutation 'R6020:Astn1'
ID 478839
Institutional Source Beutler Lab
Gene Symbol Astn1
Ensembl Gene ENSMUSG00000026587
Gene Name astrotactin 1
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R6020 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 158362273-158691781 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 158509993 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 423 (D423G)
Ref Sequence ENSEMBL: ENSMUSP00000141518 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046110] [ENSMUST00000170718] [ENSMUST00000193042] [ENSMUST00000194369] [ENSMUST00000195311]
AlphaFold Q61137
Predicted Effect probably damaging
Transcript: ENSMUST00000046110
AA Change: D423G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000039711
Gene: ENSMUSG00000026587
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000093595
Predicted Effect possibly damaging
Transcript: ENSMUST00000170718
AA Change: D423G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000127428
Gene: ENSMUSG00000026587
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
Blast:MACPF 811 835 3e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192619
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192868
Predicted Effect probably damaging
Transcript: ENSMUST00000193042
AA Change: D423G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142322
Gene: ENSMUSG00000026587
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 507 1.2e1 SMART
EGF 611 652 2.29e1 SMART
EGF_like 659 708 3.57e1 SMART
MACPF 811 999 1.11e-56 SMART
FN3 1030 1142 5.75e-2 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194369
AA Change: D423G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000142017
Gene: ENSMUSG00000026587
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
Blast:MACPF 803 828 2e-7 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000195311
AA Change: D423G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141518
Gene: ENSMUSG00000026587
AA Change: D423G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
transmembrane domain 153 175 N/A INTRINSIC
low complexity region 365 381 N/A INTRINSIC
transmembrane domain 388 410 N/A INTRINSIC
EGF 462 499 2e-2 SMART
EGF 603 644 1.1e-1 SMART
EGF_like 651 700 1.7e-1 SMART
MACPF 803 991 6.2e-59 SMART
FN3 1022 1134 2.8e-4 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Astrotactin is a neuronal adhesion molecule required for glial-guided migration of young postmitotic neuroblasts in cortical regions of developing brain, including cerebrum, hippocampus, cerebellum, and olfactory bulb (Fink et al., 1995).[supplied by OMIM, Jun 2009]
PHENOTYPE: Homozygous mutation of this gene results in reduced cerebellum size, abnormal Purkinje cell morphology, and reduced coordination performance on the Rotarod test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,145,613 V557F possibly damaging Het
Abi3 A T 11: 95,842,025 L41* probably null Het
Actn1 C A 12: 80,174,455 probably null Het
Adamts15 G T 9: 30,902,062 R936S probably benign Het
Angel2 T C 1: 190,932,871 S22P probably benign Het
Ank2 T G 3: 126,946,821 probably benign Het
Casp9 A G 4: 141,796,538 D78G probably damaging Het
Cbr4 A G 8: 61,487,853 D2G probably benign Het
Ccdc8 T A 7: 16,996,581 L665H probably damaging Het
Cdh23 T A 10: 60,331,326 N1847I probably damaging Het
Cnst T C 1: 179,609,875 W335R probably benign Het
Ddr2 T A 1: 170,005,102 I130F probably benign Het
Dnah2 C T 11: 69,500,839 A677T probably benign Het
Dzip3 C A 16: 48,951,842 W488L probably damaging Het
Ephb3 T G 16: 21,222,013 I637S probably damaging Het
Etv3 A G 3: 87,529,364 D142G probably benign Het
Fabp5 C T 3: 10,016,089 T126I probably benign Het
Fam13b A C 18: 34,494,774 Y125D probably damaging Het
Fsip2 C A 2: 82,992,127 P6068Q probably damaging Het
Gm11232 A G 4: 71,756,668 F199S possibly damaging Het
Gm340 G A 19: 41,583,547 G247D possibly damaging Het
Gm5493 A G 17: 22,748,061 K57E probably benign Het
Gm7334 A G 17: 50,699,237 M184V probably benign Het
Gm9894 T C 13: 67,763,835 noncoding transcript Het
Gpd2 T A 2: 57,364,513 N674K probably benign Het
H2-M10.6 A G 17: 36,813,067 Y141C probably damaging Het
Heatr5a C T 12: 51,884,327 E1796K probably benign Het
Hexim2 A G 11: 103,138,292 T57A probably benign Het
Hrg A T 16: 22,954,518 N134Y probably damaging Het
Hsd17b12 T C 2: 94,033,977 T262A probably damaging Het
Irak3 G T 10: 120,143,137 P470T probably damaging Het
Itgbl1 A T 14: 123,846,565 D285V probably damaging Het
Kcp A T 6: 29,502,864 V164E probably benign Het
Klhdc7b T A 15: 89,388,386 M1157K probably damaging Het
Mdc1 G A 17: 35,848,633 G635D probably benign Het
Mdc1 A G 17: 35,857,572 K1690R probably benign Het
Mpp3 A T 11: 102,018,539 probably benign Het
Ncor2 G T 5: 125,020,011 H2285N probably benign Het
Neb T A 2: 52,257,827 T2727S probably benign Het
Nkx6-2 T C 7: 139,581,567 D234G possibly damaging Het
Nlrp9c T C 7: 26,384,725 I476M probably benign Het
Nrsn1 T G 13: 25,253,372 Q191P probably damaging Het
Olfr116 A T 17: 37,623,967 S223T possibly damaging Het
Olfr390 C T 11: 73,787,552 L205F probably benign Het
Olfr610 T A 7: 103,506,799 H49L probably benign Het
Patl1 T G 19: 11,937,354 L623R probably damaging Het
Pdc T C 1: 150,333,366 I200T probably benign Het
Pdzk1 A G 3: 96,868,426 D370G probably benign Het
Pglyrp3 A T 3: 92,031,534 I339F probably damaging Het
Plxnb1 T C 9: 109,116,611 V2070A probably damaging Het
Poln G A 5: 34,109,431 R461C probably damaging Het
Prl2b1 C A 13: 27,383,508 V218L probably damaging Het
Pygl T C 12: 70,216,654 D55G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
RP24-351P7.8 T C 7: 11,610,301 F62S probably damaging Het
Rsrp1 T C 4: 134,924,381 F152S probably damaging Het
Sim2 T C 16: 94,097,251 S115P probably damaging Het
Slc17a1 T A 13: 23,875,610 I108K possibly damaging Het
Slc30a8 A G 15: 52,325,658 D223G probably damaging Het
Slc39a4 A T 15: 76,616,142 N69K probably benign Het
Slc51a T G 16: 32,479,766 T58P probably damaging Het
Slc7a14 T C 3: 31,224,112 H448R probably benign Het
Smc3 G A 19: 53,625,163 probably null Het
Sox6 A T 7: 115,486,628 D659E probably damaging Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tsr1 C T 11: 74,900,293 probably null Het
Ttc12 T C 9: 49,443,122 K565E probably damaging Het
Ube4b A T 4: 149,368,311 V386E probably benign Het
Ush2a T A 1: 188,728,096 probably null Het
Usp5 C A 6: 124,817,613 probably benign Het
Vmn1r216 T C 13: 23,099,935 F263L probably benign Het
Vmn2r88 T A 14: 51,418,149 L606* probably null Het
Wee2 T A 6: 40,449,620 probably null Het
Zfhx3 T C 8: 108,792,527 Y94H probably damaging Het
Zfp385c G A 11: 100,632,768 P120L probably benign Het
Other mutations in Astn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Astn1 APN 1 158600319 missense possibly damaging 0.71
IGL01705:Astn1 APN 1 158504313 missense probably damaging 1.00
IGL01790:Astn1 APN 1 158580327 missense possibly damaging 0.70
IGL01962:Astn1 APN 1 158668631 missense probably damaging 1.00
IGL02000:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02119:Astn1 APN 1 158511154 intron probably benign
IGL02168:Astn1 APN 1 158609341 missense possibly damaging 0.93
IGL02239:Astn1 APN 1 158664130 critical splice donor site probably null
IGL02271:Astn1 APN 1 158510950 splice site probably benign
IGL02307:Astn1 APN 1 158674614 missense probably damaging 1.00
IGL02504:Astn1 APN 1 158502408 missense probably damaging 1.00
IGL02552:Astn1 APN 1 158505395 missense possibly damaging 0.90
IGL02903:Astn1 APN 1 158688550 missense probably damaging 0.99
IGL03003:Astn1 APN 1 158612395 missense probably benign 0.00
IGL03007:Astn1 APN 1 158668623 splice site probably benign
IGL03354:Astn1 APN 1 158688604 missense probably damaging 1.00
PIT4366001:Astn1 UTSW 1 158597209 missense probably benign 0.20
PIT4366001:Astn1 UTSW 1 158597211 missense probably benign 0.23
R0024:Astn1 UTSW 1 158684215 missense probably damaging 0.99
R0050:Astn1 UTSW 1 158579724 splice site probably benign
R0099:Astn1 UTSW 1 158502151 missense probably damaging 1.00
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0109:Astn1 UTSW 1 158664104 missense possibly damaging 0.79
R0365:Astn1 UTSW 1 158688548 missense probably damaging 1.00
R0416:Astn1 UTSW 1 158509891 missense probably damaging 1.00
R0531:Astn1 UTSW 1 158600389 missense probably damaging 0.99
R0735:Astn1 UTSW 1 158472389 missense possibly damaging 0.53
R0763:Astn1 UTSW 1 158509890 missense possibly damaging 0.93
R0899:Astn1 UTSW 1 158511109 nonsense probably null
R1027:Astn1 UTSW 1 158580279 missense probably damaging 1.00
R1160:Astn1 UTSW 1 158600365 missense possibly damaging 0.83
R1474:Astn1 UTSW 1 158502353 missense probably damaging 1.00
R1517:Astn1 UTSW 1 158579576 splice site probably benign
R1701:Astn1 UTSW 1 158504307 missense possibly damaging 0.54
R1764:Astn1 UTSW 1 158504251 missense probably benign 0.35
R1860:Astn1 UTSW 1 158601945 missense probably damaging 1.00
R1889:Astn1 UTSW 1 158505316 splice site probably null
R1919:Astn1 UTSW 1 158509971 missense probably damaging 1.00
R2001:Astn1 UTSW 1 158520521 missense probably damaging 1.00
R2007:Astn1 UTSW 1 158609305 missense probably damaging 0.97
R2038:Astn1 UTSW 1 158657120 missense probably benign 0.29
R2044:Astn1 UTSW 1 158600502 missense possibly damaging 0.53
R2084:Astn1 UTSW 1 158472408 missense probably damaging 0.99
R2094:Astn1 UTSW 1 158667609 missense probably benign 0.02
R2163:Astn1 UTSW 1 158502150 missense probably damaging 0.99
R2211:Astn1 UTSW 1 158657306 missense probably benign 0.40
R2268:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2269:Astn1 UTSW 1 158502099 missense probably damaging 1.00
R2425:Astn1 UTSW 1 158579666 missense probably damaging 0.99
R2428:Astn1 UTSW 1 158612346 missense possibly damaging 0.66
R2980:Astn1 UTSW 1 158572951 critical splice acceptor site probably null
R3713:Astn1 UTSW 1 158667532 missense possibly damaging 0.83
R3745:Astn1 UTSW 1 158502060 missense probably damaging 1.00
R3926:Astn1 UTSW 1 158579657 missense possibly damaging 0.95
R4345:Astn1 UTSW 1 158502032 splice site probably null
R4625:Astn1 UTSW 1 158580294 missense probably damaging 1.00
R4627:Astn1 UTSW 1 158502251 missense possibly damaging 0.55
R4970:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5112:Astn1 UTSW 1 158657193 missense possibly damaging 0.88
R5257:Astn1 UTSW 1 158612532 missense probably damaging 1.00
R5292:Astn1 UTSW 1 158580363 critical splice donor site probably null
R5889:Astn1 UTSW 1 158600380 missense possibly damaging 0.93
R5909:Astn1 UTSW 1 158601937 missense probably damaging 1.00
R6349:Astn1 UTSW 1 158664121 nonsense probably null
R6481:Astn1 UTSW 1 158612462 missense probably benign 0.29
R6736:Astn1 UTSW 1 158511148 critical splice donor site probably null
R6833:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6834:Astn1 UTSW 1 158664122 missense probably benign 0.40
R6860:Astn1 UTSW 1 158612472 missense probably damaging 1.00
R6874:Astn1 UTSW 1 158664074 nonsense probably null
R7062:Astn1 UTSW 1 158688511 critical splice acceptor site probably null
R7133:Astn1 UTSW 1 158572987 missense probably damaging 1.00
R7355:Astn1 UTSW 1 158664276 splice site probably null
R7402:Astn1 UTSW 1 158552855 intron probably benign
R7412:Astn1 UTSW 1 158502349 missense probably damaging 0.98
R7487:Astn1 UTSW 1 158610782 splice site probably null
R7537:Astn1 UTSW 1 158505386 missense possibly damaging 0.84
R7537:Astn1 UTSW 1 158667638 splice site probably null
R7635:Astn1 UTSW 1 158667535 nonsense probably null
R7890:Astn1 UTSW 1 158580333 missense probably damaging 1.00
R7894:Astn1 UTSW 1 158601938 missense probably damaging 0.98
R7904:Astn1 UTSW 1 158597316 missense probably benign 0.37
R8048:Astn1 UTSW 1 158688638 missense probably benign 0.00
R8061:Astn1 UTSW 1 158504350 critical splice donor site probably null
R8096:Astn1 UTSW 1 158609320 missense probably damaging 1.00
R8327:Astn1 UTSW 1 158609280 missense probably damaging 1.00
R8374:Astn1 UTSW 1 158502233 missense probably damaging 1.00
R8400:Astn1 UTSW 1 158657100 missense probably benign 0.09
R8983:Astn1 UTSW 1 158664130 critical splice donor site probably null
R9013:Astn1 UTSW 1 158520500 missense probably damaging 1.00
R9110:Astn1 UTSW 1 158668757 missense probably benign 0.01
R9156:Astn1 UTSW 1 158510985 missense probably damaging 0.99
R9355:Astn1 UTSW 1 158684151 missense probably damaging 1.00
R9683:Astn1 UTSW 1 158664049 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158472497 missense possibly damaging 0.93
Z1088:Astn1 UTSW 1 158597206 missense possibly damaging 0.91
Z1088:Astn1 UTSW 1 158684096 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTTTGCTGGCAGAAGGC -3'
(R):5'- GTATTGGAGATGACCTGTCACG -3'

Sequencing Primer
(F):5'- CAGAAGGCCGAGTCATCTG -3'
(R):5'- GAGATGACCTGTCACGTTTTTC -3'
Posted On 2017-06-26