Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Gpd2'

478845

Institutional Source

Beutler Lab

Gene Symbol

Gpd2

Ensembl Gene

ENSMUSG00000026827

Gene Name

glycerol phosphate dehydrogenase 2, mitochondrial

Synonyms

Gdm1

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.641) question?

Stock #

R6020 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

57237635-57370719 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 57364513 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 674 (N674K)

Ref Sequence

ENSEMBL: ENSMUSP00000108237 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028167] [ENSMUST00000112618] [ENSMUST00000169687]

AlphaFold

Q64521

Predicted Effect

probably benign
Transcript: ENSMUST00000028167
AA Change: N656K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000028167
Gene: ENSMUSG00000026827
AA Change: N656K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112618
AA Change: N674K

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108237
Gene: ENSMUSG00000026827
AA Change: N674K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	143	4.6e-7	PFAM
Pfam:DAO	71	441	2.9e-50	PFAM
Pfam:DAO_C	462	588	2.1e-42	PFAM
EFh	645	673	1.38e1	SMART
EFh	681	709	1.27e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141536

Predicted Effect

probably benign
Transcript: ENSMUST00000169687
AA Change: N656K

PolyPhen 2 Score 0.059 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000130992
Gene: ENSMUSG00000026827
AA Change: N656K

Domain	Start	End	E-Value	Type
transmembrane domain	7	29	N/A	INTRINSIC
Pfam:FAD_binding_2	71	145	5.2e-7	PFAM
Pfam:FAD_oxidored	71	147	2.3e-9	PFAM
Pfam:DAO	71	441	8.9e-52	PFAM
EFh	627	655	1.38e1	SMART
EFh	663	691	1.27e-3	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene localizes to the inner mitochondrial membrane and catalyzes the conversion of glycerol-3-phosphate to dihydroxyacetone phosphate, using FAD as a cofactor. Along with GDP1, the encoded protein constitutes the glycerol phosphate shuttle, which reoxidizes NADH formed during glycolysis. Two transcript variants encoding the same protein have been found for this gene.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit diminished hepatic ATP levels, decreased adiposity and fasting blood glucose, and, on an inbred background, reductions in preweaning viability and fertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Gpd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00946:Gpd2	APN	2	57268084	critical splice donor site	probably null
IGL01012:Gpd2	APN	2	57364530	missense	probably benign	0.00
IGL01096:Gpd2	APN	2	57338867	missense	probably damaging	0.98
IGL01642:Gpd2	APN	2	57268071	nonsense	probably null
IGL01816:Gpd2	APN	2	57364066	nonsense	probably null
IGL02257:Gpd2	APN	2	57364524	missense	probably benign	0.01
IGL02824:Gpd2	APN	2	57364327	missense	probably null	0.89
IGL02832:Gpd2	APN	2	57338979	missense	probably damaging	1.00
IGL03040:Gpd2	APN	2	57355793	missense	probably benign	0.06
IGL03107:Gpd2	APN	2	57355569	missense	probably damaging	1.00
IGL03131:Gpd2	APN	2	57338843	splice site	probably benign
IGL03218:Gpd2	APN	2	57307054	missense	probably damaging	1.00
IGL03226:Gpd2	APN	2	57304486	critical splice donor site	probably null
IGL03372:Gpd2	APN	2	57355507	missense	probably damaging	1.00
R0012:Gpd2	UTSW	2	57338868	missense	probably damaging	1.00
R0285:Gpd2	UTSW	2	57338955	missense	probably benign	0.16
R0379:Gpd2	UTSW	2	57345263	missense	probably damaging	1.00
R0401:Gpd2	UTSW	2	57340093	missense	possibly damaging	0.94
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1347:Gpd2	UTSW	2	57357671	missense	probably damaging	0.99
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1468:Gpd2	UTSW	2	57355774	missense	probably damaging	1.00
R1490:Gpd2	UTSW	2	57355475	missense	probably damaging	1.00
R1672:Gpd2	UTSW	2	57357700	missense	probably damaging	0.97
R1709:Gpd2	UTSW	2	57357655	missense	probably damaging	1.00
R1735:Gpd2	UTSW	2	57355551	missense	probably damaging	1.00
R2056:Gpd2	UTSW	2	57339013	critical splice donor site	probably null
R2959:Gpd2	UTSW	2	57338975	nonsense	probably null
R2960:Gpd2	UTSW	2	57338975	nonsense	probably null
R2961:Gpd2	UTSW	2	57338975	nonsense	probably null
R2962:Gpd2	UTSW	2	57338975	nonsense	probably null
R3008:Gpd2	UTSW	2	57338975	nonsense	probably null
R3009:Gpd2	UTSW	2	57338975	nonsense	probably null
R3881:Gpd2	UTSW	2	57338975	nonsense	probably null
R4073:Gpd2	UTSW	2	57290013	missense	probably damaging	1.00
R4153:Gpd2	UTSW	2	57355771	missense	probably damaging	1.00
R4564:Gpd2	UTSW	2	57307083	missense	possibly damaging	0.77
R4952:Gpd2	UTSW	2	57307013	nonsense	probably null
R5030:Gpd2	UTSW	2	57304405	missense	probably damaging	0.98
R5101:Gpd2	UTSW	2	57355901	missense	probably damaging	1.00
R5185:Gpd2	UTSW	2	57340204	missense	probably damaging	1.00
R6325:Gpd2	UTSW	2	57304396	missense	probably damaging	0.96
R6536:Gpd2	UTSW	2	57345355	missense	probably benign	0.40
R6923:Gpd2	UTSW	2	57355788	missense	probably damaging	0.98
R7058:Gpd2	UTSW	2	57307100	splice site	probably null
R7380:Gpd2	UTSW	2	57340159	missense	probably damaging	1.00
R8052:Gpd2	UTSW	2	57306950	nonsense	probably null
R8098:Gpd2	UTSW	2	57290008	missense	possibly damaging	0.94
R8467:Gpd2	UTSW	2	57364584	missense	possibly damaging	0.95
R8851:Gpd2	UTSW	2	57307050	missense	possibly damaging	0.62
R9515:Gpd2	UTSW	2	57305854	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TTCAGCGTGTCCTAGAGGTG -3'
(R):5'- CTGGCTAAGGCTATGTTTTCAG -3'

Sequencing Primer
(F):5'- CGTGTCCTAGAGGTGATACATACTC -3'
(R):5'- GGCTATGTTTTCAGAATGAAGCGAC -3'

Posted On

2017-06-26