Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Stard9'

478848

Institutional Source

Beutler Lab

Gene Symbol

Stard9

Ensembl Gene

ENSMUSG00000033705

Gene Name

START domain containing 9

Synonyms

E230025N21Rik, Kif16a, 4831403C07Rik, N-3 kinesin

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R6020 (G1)

Quality Score

185.468

Status

Not validated

Chromosome

Chromosomal Location

120629121-120731895 bp(+) (GRCm38)

Type of Mutation

frame shift

DNA Base Change (assembly)

GCCC to GCC at 120693715 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000136055 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000140843] [ENSMUST00000180041]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000140843

SMART Domains

Protein: ENSMUSP00000117178
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
FHA	63	115	2.8e-4	SMART
coiled coil region	334	354	N/A	INTRINSIC
low complexity region	573	584	N/A	INTRINSIC
low complexity region	866	871	N/A	INTRINSIC
low complexity region	1023	1035	N/A	INTRINSIC
low complexity region	1234	1248	N/A	INTRINSIC
low complexity region	1765	1775	N/A	INTRINSIC
low complexity region	2546	2559	N/A	INTRINSIC
low complexity region	2953	2963	N/A	INTRINSIC
low complexity region	3269	3281	N/A	INTRINSIC
low complexity region	3421	3435	N/A	INTRINSIC
coiled coil region	3767	3808	N/A	INTRINSIC
low complexity region	3812	3821	N/A	INTRINSIC
low complexity region	3827	3844	N/A	INTRINSIC
low complexity region	3904	3925	N/A	INTRINSIC
SCOP:d1jssa_	3946	4142	1e-28	SMART
Blast:START	3947	4143	1e-10	BLAST

Predicted Effect

probably null
Transcript: ENSMUST00000180041

SMART Domains

Protein: ENSMUSP00000136055
Gene: ENSMUSG00000033705

Domain	Start	End	E-Value	Type
KISc	1	392	3.31e-143	SMART
low complexity region	398	409	N/A	INTRINSIC
FHA	481	533	2.8e-4	SMART
coiled coil region	752	772	N/A	INTRINSIC
low complexity region	991	1002	N/A	INTRINSIC
low complexity region	1284	1289	N/A	INTRINSIC
low complexity region	1441	1453	N/A	INTRINSIC
low complexity region	1652	1666	N/A	INTRINSIC
low complexity region	2183	2193	N/A	INTRINSIC
low complexity region	2964	2977	N/A	INTRINSIC
low complexity region	3371	3381	N/A	INTRINSIC
low complexity region	3687	3699	N/A	INTRINSIC
low complexity region	3839	3853	N/A	INTRINSIC
coiled coil region	4185	4226	N/A	INTRINSIC
low complexity region	4230	4239	N/A	INTRINSIC
low complexity region	4245	4262	N/A	INTRINSIC
low complexity region	4322	4343	N/A	INTRINSIC

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfhx3	T	C	8: 108,792,527	Y94H	probably damaging	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Stard9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01103:Stard9	APN	2	120701847	missense	possibly damaging	0.52
IGL01122:Stard9	APN	2	120698479	missense	possibly damaging	0.93
IGL01318:Stard9	APN	2	120698719	missense	possibly damaging	0.56
IGL01371:Stard9	APN	2	120701368	missense	probably benign	0.04
IGL01394:Stard9	APN	2	120706327	missense	possibly damaging	0.78
IGL01531:Stard9	APN	2	120673604	missense	possibly damaging	0.93
IGL01721:Stard9	APN	2	120703330	missense	probably damaging	1.00
IGL01810:Stard9	APN	2	120699084	missense	possibly damaging	0.95
IGL01829:Stard9	APN	2	120706446	missense	possibly damaging	0.59
IGL01916:Stard9	APN	2	120668016	missense	probably damaging	1.00
IGL02031:Stard9	APN	2	120702339	missense	probably benign	0.27
IGL02081:Stard9	APN	2	120664910	missense	probably damaging	0.98
IGL02558:Stard9	APN	2	120696907	missense	possibly damaging	0.95
IGL02646:Stard9	APN	2	120698992	missense	probably damaging	1.00
IGL02873:Stard9	APN	2	120713807	missense	probably damaging	1.00
IGL03195:Stard9	APN	2	120705802	missense	probably damaging	1.00
IGL03204:Stard9	APN	2	120705802	missense	probably damaging	1.00
FR4737:Stard9	UTSW	2	120696085	small insertion	probably benign
IGL03014:Stard9	UTSW	2	120702194	unclassified	probably benign
PIT4151001:Stard9	UTSW	2	120702756	nonsense	probably null
PIT4498001:Stard9	UTSW	2	120697435	missense	possibly damaging	0.86
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0027:Stard9	UTSW	2	120703501	missense	probably benign
R0038:Stard9	UTSW	2	120695832	missense	probably benign
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0049:Stard9	UTSW	2	120699819	missense	probably damaging	1.00
R0116:Stard9	UTSW	2	120634255	missense	probably damaging	0.99
R0398:Stard9	UTSW	2	120696307	missense	probably benign	0.03
R0479:Stard9	UTSW	2	120697596	missense	probably damaging	1.00
R0556:Stard9	UTSW	2	120698923	missense	probably benign	0.09
R0589:Stard9	UTSW	2	120698547	missense	probably benign	0.00
R0609:Stard9	UTSW	2	120706306	missense	probably damaging	1.00
R0611:Stard9	UTSW	2	120699257	missense	probably benign	0.00
R0683:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0751:Stard9	UTSW	2	120697485	missense	probably benign	0.04
R0833:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0836:Stard9	UTSW	2	120696999	missense	possibly damaging	0.86
R0838:Stard9	UTSW	2	120700842	missense	probably damaging	1.00
R0848:Stard9	UTSW	2	120695823	missense	probably damaging	1.00
R0849:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R0961:Stard9	UTSW	2	120693439	missense	probably benign	0.01
R0993:Stard9	UTSW	2	120705169	missense	probably damaging	1.00
R1005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1006:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1115:Stard9	UTSW	2	120692850	missense	probably benign	0.05
R1163:Stard9	UTSW	2	120696213	missense	possibly damaging	0.86
R1199:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1200:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1331:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1332:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1333:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1334:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1335:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1336:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1338:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1346:Stard9	UTSW	2	120713448	missense	probably damaging	1.00
R1370:Stard9	UTSW	2	120697477	missense	probably benign	0.11
R1384:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1401:Stard9	UTSW	2	120712847	splice site	probably benign
R1416:Stard9	UTSW	2	120700972	missense	probably benign	0.00
R1453:Stard9	UTSW	2	120666376	missense	probably damaging	1.00
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1468:Stard9	UTSW	2	120703197	missense	possibly damaging	0.90
R1525:Stard9	UTSW	2	120702052	missense	probably benign	0.09
R1538:Stard9	UTSW	2	120696711	missense	probably benign	0.25
R1614:Stard9	UTSW	2	120697675	missense	possibly damaging	0.95
R1654:Stard9	UTSW	2	120703722	missense	probably benign	0.37
R1658:Stard9	UTSW	2	120701542	missense	probably benign	0.02
R1686:Stard9	UTSW	2	120699492	missense	probably benign	0.00
R1797:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1803:Stard9	UTSW	2	120701489	missense	probably benign	0.24
R1806:Stard9	UTSW	2	120679453	splice site	probably null
R1847:Stard9	UTSW	2	120698489	missense	possibly damaging	0.51
R1853:Stard9	UTSW	2	120688751	missense	probably damaging	1.00
R1892:Stard9	UTSW	2	120693708	missense	probably benign	0.01
R1906:Stard9	UTSW	2	120696427	missense	probably benign	0.00
R1907:Stard9	UTSW	2	120713812	missense	probably damaging	1.00
R1930:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R1933:Stard9	UTSW	2	120698656	missense	possibly damaging	0.55
R1989:Stard9	UTSW	2	120701406	missense	probably benign
R1999:Stard9	UTSW	2	120692868	missense	probably damaging	0.99
R2004:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2005:Stard9	UTSW	2	120664945	missense	possibly damaging	0.90
R2005:Stard9	UTSW	2	120673636	missense	probably damaging	1.00
R2021:Stard9	UTSW	2	120704235	missense	probably benign	0.05
R2025:Stard9	UTSW	2	120702398	missense	probably benign	0.20
R2190:Stard9	UTSW	2	120714120	missense	probably benign	0.22
R2204:Stard9	UTSW	2	120698531	frame shift	probably null
R2422:Stard9	UTSW	2	120700284	missense	probably benign	0.29
R3401:Stard9	UTSW	2	120703689	missense	probably damaging	0.98
R3618:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3619:Stard9	UTSW	2	120699019	missense	possibly damaging	0.49
R3900:Stard9	UTSW	2	120713549	missense	possibly damaging	0.93
R3943:Stard9	UTSW	2	120698229	missense	probably benign	0.11
R4022:Stard9	UTSW	2	120704155	missense	probably benign	0.05
R4223:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4224:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4225:Stard9	UTSW	2	120664991	missense	possibly damaging	0.95
R4345:Stard9	UTSW	2	120701946	missense	probably benign	0.43
R4382:Stard9	UTSW	2	120634222	missense	probably damaging	1.00
R4453:Stard9	UTSW	2	120697791	missense	probably benign
R4499:Stard9	UTSW	2	120700241	missense	probably benign	0.05
R4524:Stard9	UTSW	2	120696445	missense	probably damaging	1.00
R4671:Stard9	UTSW	2	120698640	missense	probably damaging	0.98
R4701:Stard9	UTSW	2	120705713	missense	possibly damaging	0.85
R4744:Stard9	UTSW	2	120696123	missense	probably benign	0.01
R4822:Stard9	UTSW	2	120695941	missense	possibly damaging	0.94
R4847:Stard9	UTSW	2	120703113	missense	probably benign	0.18
R4863:Stard9	UTSW	2	120700860	missense	probably benign	0.00
R4898:Stard9	UTSW	2	120706419	nonsense	probably null
R5033:Stard9	UTSW	2	120693399	missense	probably benign	0.00
R5087:Stard9	UTSW	2	120697019	nonsense	probably null
R5157:Stard9	UTSW	2	120697861	missense	probably benign
R5213:Stard9	UTSW	2	120699226	missense	probably damaging	1.00
R5237:Stard9	UTSW	2	120699358	missense	probably damaging	0.96
R5257:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5258:Stard9	UTSW	2	120699343	missense	probably damaging	0.99
R5273:Stard9	UTSW	2	120705087	missense	possibly damaging	0.94
R5286:Stard9	UTSW	2	120701947	missense	probably benign	0.43
R5288:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5292:Stard9	UTSW	2	120699145	missense	probably benign	0.17
R5328:Stard9	UTSW	2	120699230	missense	probably damaging	1.00
R5385:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5386:Stard9	UTSW	2	120700630	missense	probably damaging	0.98
R5393:Stard9	UTSW	2	120702906	missense	possibly damaging	0.87
R5405:Stard9	UTSW	2	120693668	missense	probably benign	0.17
R5685:Stard9	UTSW	2	120705322	missense	probably damaging	1.00
R5749:Stard9	UTSW	2	120703786	missense	probably damaging	1.00
R5780:Stard9	UTSW	2	120703396	missense	probably benign	0.02
R5901:Stard9	UTSW	2	120701370	missense	probably damaging	1.00
R5941:Stard9	UTSW	2	120713558	missense	probably damaging	1.00
R5960:Stard9	UTSW	2	120699961	missense	probably benign	0.05
R5966:Stard9	UTSW	2	120697099	missense	probably damaging	1.00
R5967:Stard9	UTSW	2	120706894	missense	probably damaging	0.99
R6012:Stard9	UTSW	2	120704586	missense	probably damaging	1.00
R6019:Stard9	UTSW	2	120693715	frame shift	probably null
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6036:Stard9	UTSW	2	120700075	missense	probably benign	0.09
R6090:Stard9	UTSW	2	120693654	missense	probably damaging	0.99
R6192:Stard9	UTSW	2	120696760	missense	probably damaging	0.99
R6228:Stard9	UTSW	2	120713750	missense	probably damaging	1.00
R6235:Stard9	UTSW	2	120713546	missense	probably damaging	1.00
R6280:Stard9	UTSW	2	120701127	missense	probably benign
R6338:Stard9	UTSW	2	120697485	missense	probably benign
R6344:Stard9	UTSW	2	120704320	missense	probably benign	0.12
R6364:Stard9	UTSW	2	120713429	missense	probably damaging	1.00
R6383:Stard9	UTSW	2	120666407	critical splice donor site	probably null
R6644:Stard9	UTSW	2	120695772	missense	probably benign	0.11
R6747:Stard9	UTSW	2	120698383	missense	possibly damaging	0.62
R6833:Stard9	UTSW	2	120701259	missense	probably damaging	1.00
R6836:Stard9	UTSW	2	120699843	missense	probably benign	0.15
R6861:Stard9	UTSW	2	120705186	missense	probably benign	0.09
R6872:Stard9	UTSW	2	120714068	nonsense	probably null
R6875:Stard9	UTSW	2	120697436	missense	probably benign	0.04
R6915:Stard9	UTSW	2	120702630	missense	probably benign	0.00
R6934:Stard9	UTSW	2	120697695	missense	probably benign	0.00
R6943:Stard9	UTSW	2	120702196	missense	probably benign	0.29
R7009:Stard9	UTSW	2	120697191	missense	probably benign	0.37
R7031:Stard9	UTSW	2	120700450	missense	possibly damaging	0.61
R7132:Stard9	UTSW	2	120679378	nonsense	probably null
R7151:Stard9	UTSW	2	120696142	missense	probably benign
R7154:Stard9	UTSW	2	120701314	missense	probably benign	0.00
R7154:Stard9	UTSW	2	120704542	missense	probably benign	0.02
R7165:Stard9	UTSW	2	120704158	missense	probably damaging	1.00
R7260:Stard9	UTSW	2	120706938	missense	possibly damaging	0.90
R7270:Stard9	UTSW	2	120634274	nonsense	probably null
R7282:Stard9	UTSW	2	120698503	missense	probably benign	0.00
R7344:Stard9	UTSW	2	120704686	missense	possibly damaging	0.90
R7347:Stard9	UTSW	2	120666534	missense	probably benign
R7359:Stard9	UTSW	2	120698280	missense	probably damaging	1.00
R7375:Stard9	UTSW	2	120665002	splice site	probably null
R7410:Stard9	UTSW	2	120701497	missense	probably benign	0.41
R7422:Stard9	UTSW	2	120702152	missense	probably benign	0.21
R7475:Stard9	UTSW	2	120688110	missense	probably damaging	1.00
R7523:Stard9	UTSW	2	120699597	missense	probably benign
R7553:Stard9	UTSW	2	120693808	splice site	probably null
R7624:Stard9	UTSW	2	120688146	missense	probably benign	0.15
R7761:Stard9	UTSW	2	120699379	missense	probably benign	0.00
R7794:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R7819:Stard9	UTSW	2	120700984	missense	probably damaging	1.00
R7823:Stard9	UTSW	2	120702106	missense	probably damaging	0.96
R7837:Stard9	UTSW	2	120703665	missense	probably benign	0.06
R7889:Stard9	UTSW	2	120704461	missense	probably benign	0.11
R7905:Stard9	UTSW	2	120696081	missense	not run
R7956:Stard9	UTSW	2	120705371	nonsense	probably null
R8013:Stard9	UTSW	2	120688101	missense	probably damaging	1.00
R8113:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8114:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8116:Stard9	UTSW	2	120664939	nonsense	probably null
R8117:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8118:Stard9	UTSW	2	120704430	missense	probably benign	0.01
R8170:Stard9	UTSW	2	120700048	missense	possibly damaging	0.76
R8300:Stard9	UTSW	2	120704769	missense	possibly damaging	0.71
R8333:Stard9	UTSW	2	120701789	missense	probably benign	0.00
R8337:Stard9	UTSW	2	120679825	missense	probably damaging	1.00
R8536:Stard9	UTSW	2	120714659	missense	possibly damaging	0.93
R8682:Stard9	UTSW	2	120703315	missense	possibly damaging	0.65
R8696:Stard9	UTSW	2	120701114	missense	probably benign	0.02
R8708:Stard9	UTSW	2	120703578	missense	probably damaging	1.00
R8732:Stard9	UTSW	2	120679961	missense	probably damaging	1.00
R8798:Stard9	UTSW	2	120704731	missense	probably benign	0.09
R8807:Stard9	UTSW	2	120705451	missense	probably damaging	1.00
R8807:Stard9	UTSW	2	120705462	missense	probably damaging	1.00
R8862:Stard9	UTSW	2	120703618	missense	probably benign
R8920:Stard9	UTSW	2	120702607	missense	probably damaging	0.96
R9026:Stard9	UTSW	2	120705802	missense	probably damaging	1.00
R9048:Stard9	UTSW	2	120677934	missense	probably damaging	0.99
R9049:Stard9	UTSW	2	120679937	missense	probably benign	0.30
R9152:Stard9	UTSW	2	120698587	missense	probably damaging	0.99
R9189:Stard9	UTSW	2	120703019	missense	possibly damaging	0.95
R9238:Stard9	UTSW	2	120697966	missense	probably damaging	1.00
R9372:Stard9	UTSW	2	120664939	nonsense	probably null
R9393:Stard9	UTSW	2	120688175	missense	possibly damaging	0.88
R9444:Stard9	UTSW	2	120664933	missense	probably damaging	1.00
R9514:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9515:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9516:Stard9	UTSW	2	120704083	missense	probably damaging	1.00
R9570:Stard9	UTSW	2	120704233	missense	probably benign	0.02
R9649:Stard9	UTSW	2	120696154	missense	probably benign	0.20
R9789:Stard9	UTSW	2	120679936	missense	probably damaging	1.00
X0023:Stard9	UTSW	2	120702744	missense	probably benign	0.00
X0023:Stard9	UTSW	2	120702963	missense	possibly damaging	0.92
Z1176:Stard9	UTSW	2	120695818	missense	probably benign	0.01
Z1176:Stard9	UTSW	2	120696612	missense	probably benign
Z1176:Stard9	UTSW	2	120698322	missense	probably damaging	1.00
Z1177:Stard9	UTSW	2	120673676	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCCAAAGCCAGAAGAGGGT -3'
(R):5'- TCACAGACCAAGCAGCAGGA -3'

Sequencing Primer
(F):5'- GAGACATACTACTCGGGCTACC -3'
(R):5'- CAGGAGCACTGCCCTGC -3'

Posted On

2017-06-26