Incidental Mutation 'R6020:Slc7a14'
ID478850
Institutional Source Beutler Lab
Gene Symbol Slc7a14
Ensembl Gene ENSMUSG00000069072
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 14
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock #R6020 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location31202858-31310378 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31224112 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 448 (H448R)
Ref Sequence ENSEMBL: ENSMUSP00000103880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091259] [ENSMUST00000108245]
Predicted Effect probably benign
Transcript: ENSMUST00000091259
AA Change: H448R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000088803
Gene: ENSMUSG00000069072
AA Change: H448R

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 443 2.1e-44 PFAM
Pfam:AA_permease 57 436 7.2e-38 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 677 9.2e-21 PFAM
low complexity region 737 757 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108245
AA Change: H448R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000103880
Gene: ENSMUSG00000069072
AA Change: H448R

DomainStartEndE-ValueType
Pfam:AA_permease_2 53 445 2.5e-46 PFAM
Pfam:AA_permease 57 437 6.9e-41 PFAM
transmembrane domain 563 585 N/A INTRINSIC
transmembrane domain 595 617 N/A INTRINSIC
Pfam:AA_permease_C 627 668 1.4e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is predicted to encode a glycosylated, cationic amino acid transporter protein with 14 transmembrane domains. This gene is primarily expressed in skin fibroblasts, neural tissue, and primary endothelial cells and its protein is predicted to mediate lysosomal uptake of cationic amino acids. Mutations in this gene are associated with autosomal recessive retinitis pigmentosa. In mice, this gene is expressed in the photoreceptor layer of the retina where its expression increases over the course of retinal development and persists in the mature retina. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal eye electrophysiology, thin retinal outer nuclear and decreased total retinal thickness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,145,613 V557F possibly damaging Het
Abi3 A T 11: 95,842,025 L41* probably null Het
Actn1 C A 12: 80,174,455 probably null Het
Adamts15 G T 9: 30,902,062 R936S probably benign Het
Angel2 T C 1: 190,932,871 S22P probably benign Het
Ank2 T G 3: 126,946,821 probably benign Het
Astn1 A G 1: 158,509,993 D423G probably damaging Het
Casp9 A G 4: 141,796,538 D78G probably damaging Het
Cbr4 A G 8: 61,487,853 D2G probably benign Het
Ccdc8 T A 7: 16,996,581 L665H probably damaging Het
Cdh23 T A 10: 60,331,326 N1847I probably damaging Het
Cnst T C 1: 179,609,875 W335R probably benign Het
Ddr2 T A 1: 170,005,102 I130F probably benign Het
Dnah2 C T 11: 69,500,839 A677T probably benign Het
Dzip3 C A 16: 48,951,842 W488L probably damaging Het
Ephb3 T G 16: 21,222,013 I637S probably damaging Het
Etv3 A G 3: 87,529,364 D142G probably benign Het
Fabp5 C T 3: 10,016,089 T126I probably benign Het
Fam13b A C 18: 34,494,774 Y125D probably damaging Het
Fsip2 C A 2: 82,992,127 P6068Q probably damaging Het
Gm11232 A G 4: 71,756,668 F199S possibly damaging Het
Gm340 G A 19: 41,583,547 G247D possibly damaging Het
Gm5493 A G 17: 22,748,061 K57E probably benign Het
Gm7334 A G 17: 50,699,237 M184V probably benign Het
Gm9894 T C 13: 67,763,835 noncoding transcript Het
Gpd2 T A 2: 57,364,513 N674K probably benign Het
H2-M10.6 A G 17: 36,813,067 Y141C probably damaging Het
Heatr5a C T 12: 51,884,327 E1796K probably benign Het
Hexim2 A G 11: 103,138,292 T57A probably benign Het
Hrg A T 16: 22,954,518 N134Y probably damaging Het
Hsd17b12 T C 2: 94,033,977 T262A probably damaging Het
Irak3 G T 10: 120,143,137 P470T probably damaging Het
Itgbl1 A T 14: 123,846,565 D285V probably damaging Het
Kcp A T 6: 29,502,864 V164E probably benign Het
Klhdc7b T A 15: 89,388,386 M1157K probably damaging Het
Mdc1 G A 17: 35,848,633 G635D probably benign Het
Mdc1 A G 17: 35,857,572 K1690R probably benign Het
Mpp3 A T 11: 102,018,539 probably benign Het
Ncor2 G T 5: 125,020,011 H2285N probably benign Het
Neb T A 2: 52,257,827 T2727S probably benign Het
Nkx6-2 T C 7: 139,581,567 D234G possibly damaging Het
Nlrp9c T C 7: 26,384,725 I476M probably benign Het
Nrsn1 T G 13: 25,253,372 Q191P probably damaging Het
Olfr116 A T 17: 37,623,967 S223T possibly damaging Het
Olfr390 C T 11: 73,787,552 L205F probably benign Het
Olfr610 T A 7: 103,506,799 H49L probably benign Het
Patl1 T G 19: 11,937,354 L623R probably damaging Het
Pdc T C 1: 150,333,366 I200T probably benign Het
Pdzk1 A G 3: 96,868,426 D370G probably benign Het
Pglyrp3 A T 3: 92,031,534 I339F probably damaging Het
Plxnb1 T C 9: 109,116,611 V2070A probably damaging Het
Poln G A 5: 34,109,431 R461C probably damaging Het
Prl2b1 C A 13: 27,383,508 V218L probably damaging Het
Pygl T C 12: 70,216,654 D55G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
RP24-351P7.8 T C 7: 11,610,301 F62S probably damaging Het
Rsrp1 T C 4: 134,924,381 F152S probably damaging Het
Sim2 T C 16: 94,097,251 S115P probably damaging Het
Slc17a1 T A 13: 23,875,610 I108K possibly damaging Het
Slc30a8 A G 15: 52,325,658 D223G probably damaging Het
Slc39a4 A T 15: 76,616,142 N69K probably benign Het
Slc51a T G 16: 32,479,766 T58P probably damaging Het
Smc3 G A 19: 53,625,163 probably null Het
Sox6 A T 7: 115,486,628 D659E probably damaging Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tsr1 C T 11: 74,900,293 probably null Het
Ttc12 T C 9: 49,443,122 K565E probably damaging Het
Ube4b A T 4: 149,368,311 V386E probably benign Het
Ush2a T A 1: 188,728,096 probably null Het
Usp5 C A 6: 124,817,613 probably benign Het
Vmn1r216 T C 13: 23,099,935 F263L probably benign Het
Vmn2r88 T A 14: 51,418,149 L606* probably null Het
Wee2 T A 6: 40,449,620 probably null Het
Zfhx3 T C 8: 108,792,527 Y94H probably damaging Het
Zfp385c G A 11: 100,632,768 P120L probably benign Het
Other mutations in Slc7a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Slc7a14 APN 3 31238678 missense probably damaging 1.00
IGL02713:Slc7a14 APN 3 31257763 missense probably damaging 0.96
IGL03341:Slc7a14 APN 3 31238770 missense probably damaging 1.00
IGL03350:Slc7a14 APN 3 31237409 missense probably benign 0.35
IGL03379:Slc7a14 APN 3 31223515 missense probably damaging 1.00
R0064:Slc7a14 UTSW 3 31227060 missense probably damaging 1.00
R1549:Slc7a14 UTSW 3 31224118 missense possibly damaging 0.94
R1591:Slc7a14 UTSW 3 31237449 missense probably damaging 1.00
R2054:Slc7a14 UTSW 3 31237362 splice site probably benign
R2057:Slc7a14 UTSW 3 31237496 missense probably damaging 1.00
R2442:Slc7a14 UTSW 3 31230320 missense probably damaging 1.00
R2504:Slc7a14 UTSW 3 31237501 missense possibly damaging 0.85
R3848:Slc7a14 UTSW 3 31237474 missense probably damaging 1.00
R4653:Slc7a14 UTSW 3 31257682 missense probably damaging 1.00
R4702:Slc7a14 UTSW 3 31230398 missense probably damaging 1.00
R5043:Slc7a14 UTSW 3 31237466 missense probably damaging 1.00
R5187:Slc7a14 UTSW 3 31237365 splice site probably null
R5345:Slc7a14 UTSW 3 31223857 missense probably damaging 0.99
R5393:Slc7a14 UTSW 3 31257770 missense probably damaging 1.00
R5421:Slc7a14 UTSW 3 31224197 missense probably damaging 1.00
R5736:Slc7a14 UTSW 3 31223910 missense probably benign 0.00
R5771:Slc7a14 UTSW 3 31238707 missense probably damaging 1.00
R5896:Slc7a14 UTSW 3 31257570 missense probably damaging 1.00
R5996:Slc7a14 UTSW 3 31209236 missense probably benign
R6107:Slc7a14 UTSW 3 31257610 missense probably damaging 1.00
R6140:Slc7a14 UTSW 3 31237548 missense probably benign
R6491:Slc7a14 UTSW 3 31223944 missense probably damaging 1.00
R6846:Slc7a14 UTSW 3 31224223 missense probably damaging 1.00
R6990:Slc7a14 UTSW 3 31223579 missense possibly damaging 0.90
R7184:Slc7a14 UTSW 3 31227063 missense probably damaging 0.98
R7271:Slc7a14 UTSW 3 31224235 missense probably damaging 1.00
R7282:Slc7a14 UTSW 3 31227153 missense possibly damaging 0.67
R7331:Slc7a14 UTSW 3 31257731 missense probably benign 0.00
Z1088:Slc7a14 UTSW 3 31223999 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TATCCACAGTGCCGTAGTTG -3'
(R):5'- ACACCAGTGGTAGCTTGCATAG -3'

Sequencing Primer
(F):5'- ACAGTGCCGTAGTTGGGGTG -3'
(R):5'- AGCTTGCATAGTGTCAGGC -3'
Posted On2017-06-26