Incidental Mutation 'R6020:Etv3'
ID478851
Institutional Source Beutler Lab
Gene Symbol Etv3
Ensembl Gene ENSMUSG00000003382
Gene Nameets variant 3
SynonymsETS-domain transcriptional repressor, Pe1, METS
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6020 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location87525407-87540156 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87529364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 142 (D142G)
Ref Sequence ENSEMBL: ENSMUSP00000114047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117293] [ENSMUST00000119109] [ENSMUST00000170036]
Predicted Effect probably benign
Transcript: ENSMUST00000117293
AA Change: D142G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114047
Gene: ENSMUSG00000003382
AA Change: D142G

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119109
SMART Domains Protein: ENSMUSP00000112915
Gene: ENSMUSG00000003382

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136680
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152010
Predicted Effect probably benign
Transcript: ENSMUST00000170036
SMART Domains Protein: ENSMUSP00000127419
Gene: ENSMUSG00000003382

DomainStartEndE-ValueType
ETS 34 120 2.74e-51 SMART
low complexity region 170 177 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 504 513 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,145,613 V557F possibly damaging Het
Abi3 A T 11: 95,842,025 L41* probably null Het
Actn1 C A 12: 80,174,455 probably null Het
Adamts15 G T 9: 30,902,062 R936S probably benign Het
Angel2 T C 1: 190,932,871 S22P probably benign Het
Ank2 T G 3: 126,946,821 probably benign Het
Astn1 A G 1: 158,509,993 D423G probably damaging Het
Casp9 A G 4: 141,796,538 D78G probably damaging Het
Cbr4 A G 8: 61,487,853 D2G probably benign Het
Ccdc8 T A 7: 16,996,581 L665H probably damaging Het
Cdh23 T A 10: 60,331,326 N1847I probably damaging Het
Cnst T C 1: 179,609,875 W335R probably benign Het
Ddr2 T A 1: 170,005,102 I130F probably benign Het
Dnah2 C T 11: 69,500,839 A677T probably benign Het
Dzip3 C A 16: 48,951,842 W488L probably damaging Het
Ephb3 T G 16: 21,222,013 I637S probably damaging Het
Fabp5 C T 3: 10,016,089 T126I probably benign Het
Fam13b A C 18: 34,494,774 Y125D probably damaging Het
Fsip2 C A 2: 82,992,127 P6068Q probably damaging Het
Gm11232 A G 4: 71,756,668 F199S possibly damaging Het
Gm340 G A 19: 41,583,547 G247D possibly damaging Het
Gm5493 A G 17: 22,748,061 K57E probably benign Het
Gm7334 A G 17: 50,699,237 M184V probably benign Het
Gm9894 T C 13: 67,763,835 noncoding transcript Het
Gpd2 T A 2: 57,364,513 N674K probably benign Het
H2-M10.6 A G 17: 36,813,067 Y141C probably damaging Het
Heatr5a C T 12: 51,884,327 E1796K probably benign Het
Hexim2 A G 11: 103,138,292 T57A probably benign Het
Hrg A T 16: 22,954,518 N134Y probably damaging Het
Hsd17b12 T C 2: 94,033,977 T262A probably damaging Het
Irak3 G T 10: 120,143,137 P470T probably damaging Het
Itgbl1 A T 14: 123,846,565 D285V probably damaging Het
Kcp A T 6: 29,502,864 V164E probably benign Het
Klhdc7b T A 15: 89,388,386 M1157K probably damaging Het
Mdc1 G A 17: 35,848,633 G635D probably benign Het
Mdc1 A G 17: 35,857,572 K1690R probably benign Het
Mpp3 A T 11: 102,018,539 probably benign Het
Ncor2 G T 5: 125,020,011 H2285N probably benign Het
Neb T A 2: 52,257,827 T2727S probably benign Het
Nkx6-2 T C 7: 139,581,567 D234G possibly damaging Het
Nlrp9c T C 7: 26,384,725 I476M probably benign Het
Nrsn1 T G 13: 25,253,372 Q191P probably damaging Het
Olfr116 A T 17: 37,623,967 S223T possibly damaging Het
Olfr390 C T 11: 73,787,552 L205F probably benign Het
Olfr610 T A 7: 103,506,799 H49L probably benign Het
Patl1 T G 19: 11,937,354 L623R probably damaging Het
Pdc T C 1: 150,333,366 I200T probably benign Het
Pdzk1 A G 3: 96,868,426 D370G probably benign Het
Pglyrp3 A T 3: 92,031,534 I339F probably damaging Het
Plxnb1 T C 9: 109,116,611 V2070A probably damaging Het
Poln G A 5: 34,109,431 R461C probably damaging Het
Prl2b1 C A 13: 27,383,508 V218L probably damaging Het
Pygl T C 12: 70,216,654 D55G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
RP24-351P7.8 T C 7: 11,610,301 F62S probably damaging Het
Rsrp1 T C 4: 134,924,381 F152S probably damaging Het
Sim2 T C 16: 94,097,251 S115P probably damaging Het
Slc17a1 T A 13: 23,875,610 I108K possibly damaging Het
Slc30a8 A G 15: 52,325,658 D223G probably damaging Het
Slc39a4 A T 15: 76,616,142 N69K probably benign Het
Slc51a T G 16: 32,479,766 T58P probably damaging Het
Slc7a14 T C 3: 31,224,112 H448R probably benign Het
Smc3 G A 19: 53,625,163 probably null Het
Sox6 A T 7: 115,486,628 D659E probably damaging Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tsr1 C T 11: 74,900,293 probably null Het
Ttc12 T C 9: 49,443,122 K565E probably damaging Het
Ube4b A T 4: 149,368,311 V386E probably benign Het
Ush2a T A 1: 188,728,096 probably null Het
Usp5 C A 6: 124,817,613 probably benign Het
Vmn1r216 T C 13: 23,099,935 F263L probably benign Het
Vmn2r88 T A 14: 51,418,149 L606* probably null Het
Wee2 T A 6: 40,449,620 probably null Het
Zfhx3 T C 8: 108,792,527 Y94H probably damaging Het
Zfp385c G A 11: 100,632,768 P120L probably benign Het
Other mutations in Etv3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01514:Etv3 APN 3 87535718 missense possibly damaging 0.68
IGL02613:Etv3 APN 3 87536395 missense possibly damaging 0.53
IGL02698:Etv3 APN 3 87536578 missense possibly damaging 0.53
Rodeo UTSW 3 87536031 nonsense probably null
Schooled UTSW 3 87529270 missense probably damaging 1.00
R0056:Etv3 UTSW 3 87535828 missense possibly damaging 0.86
R2074:Etv3 UTSW 3 87536219 missense probably benign
R2104:Etv3 UTSW 3 87536062 missense possibly damaging 0.53
R4120:Etv3 UTSW 3 87536282 missense probably benign 0.00
R4923:Etv3 UTSW 3 87535916 missense possibly damaging 0.96
R4960:Etv3 UTSW 3 87528061 missense probably damaging 1.00
R5642:Etv3 UTSW 3 87536015 missense possibly damaging 0.96
R5907:Etv3 UTSW 3 87535543 missense probably benign 0.23
R6882:Etv3 UTSW 3 87529270 missense probably damaging 1.00
R7515:Etv3 UTSW 3 87528056 missense possibly damaging 0.58
R7570:Etv3 UTSW 3 87536031 nonsense probably null
R8340:Etv3 UTSW 3 87536549 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- ATGCTGAACCGTGTGTCCTTC -3'
(R):5'- TCAGTTGCTCTCCAGGAGAC -3'

Sequencing Primer
(F):5'- GAACCGTGTGTCCTTCCTTTGTAG -3'
(R):5'- AAGCAAGCGTATCGGAGCCC -3'
Posted On2017-06-26