Incidental Mutation 'R6020:Kcp'
ID478861
Institutional Source Beutler Lab
Gene Symbol Kcp
Ensembl Gene ENSMUSG00000059022
Gene Namekielin/chordin-like protein
SynonymsCrim2, KCP, LOC333088
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R6020 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location29473162-29507952 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29502864 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 164 (V164E)
Ref Sequence ENSEMBL: ENSMUSP00000099135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078112] [ENSMUST00000091391] [ENSMUST00000101614] [ENSMUST00000161237]
Predicted Effect probably benign
Transcript: ENSMUST00000078112
AA Change: V164E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077251
Gene: ENSMUSG00000059022
AA Change: V164E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
Pfam:VWD 1214 1254 4.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000091391
AA Change: V164E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000088954
Gene: ENSMUSG00000059022
AA Change: V164E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 7e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1082 6.53e-9 SMART
VWC 1089 1142 1.05e-3 SMART
VWC 1149 1206 2.93e-11 SMART
Pfam:VWD 1213 1253 4.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101614
AA Change: V164E

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099135
Gene: ENSMUSG00000059022
AA Change: V164E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1fxkc_ 64 91 8e-3 SMART
VWC 136 190 1.41e-13 SMART
VWC 194 250 1.24e-9 SMART
VWC 255 311 4.55e-8 SMART
VWC 314 369 8.88e-11 SMART
VWC 428 484 9.15e-13 SMART
VWC 487 543 7.61e-10 SMART
VWC 546 601 4.05e-5 SMART
VWC 604 660 8.28e-11 SMART
VWC 667 723 6.58e-5 SMART
VWC 726 780 2.14e-4 SMART
VWC 783 839 1.98e-8 SMART
VWC 842 898 1.35e-1 SMART
VWC 901 957 5.77e-10 SMART
VWC 960 1015 1.21e-3 SMART
VWC 1018 1083 2.44e-8 SMART
VWC 1090 1143 1.05e-3 SMART
VWC 1150 1207 2.93e-11 SMART
VWD 1201 1362 6.09e-50 SMART
C8 1404 1479 1.55e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160181
SMART Domains Protein: ENSMUSP00000125699
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
VWC 18 74 1.24e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161237
SMART Domains Protein: ENSMUSP00000124097
Gene: ENSMUSG00000059022

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
coiled coil region 60 92 N/A INTRINSIC
internal_repeat_1 94 117 8.56e-6 PROSPERO
internal_repeat_1 136 159 8.56e-6 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162959
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181540
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.8%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display increased sensitivity to renal injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 C A 11: 110,145,613 V557F possibly damaging Het
Abi3 A T 11: 95,842,025 L41* probably null Het
Actn1 C A 12: 80,174,455 probably null Het
Adamts15 G T 9: 30,902,062 R936S probably benign Het
Angel2 T C 1: 190,932,871 S22P probably benign Het
Ank2 T G 3: 126,946,821 probably benign Het
Astn1 A G 1: 158,509,993 D423G probably damaging Het
Casp9 A G 4: 141,796,538 D78G probably damaging Het
Cbr4 A G 8: 61,487,853 D2G probably benign Het
Ccdc8 T A 7: 16,996,581 L665H probably damaging Het
Cdh23 T A 10: 60,331,326 N1847I probably damaging Het
Cnst T C 1: 179,609,875 W335R probably benign Het
Ddr2 T A 1: 170,005,102 I130F probably benign Het
Dnah2 C T 11: 69,500,839 A677T probably benign Het
Dzip3 C A 16: 48,951,842 W488L probably damaging Het
Ephb3 T G 16: 21,222,013 I637S probably damaging Het
Etv3 A G 3: 87,529,364 D142G probably benign Het
Fabp5 C T 3: 10,016,089 T126I probably benign Het
Fam13b A C 18: 34,494,774 Y125D probably damaging Het
Fsip2 C A 2: 82,992,127 P6068Q probably damaging Het
Gm11232 A G 4: 71,756,668 F199S possibly damaging Het
Gm340 G A 19: 41,583,547 G247D possibly damaging Het
Gm5493 A G 17: 22,748,061 K57E probably benign Het
Gm7334 A G 17: 50,699,237 M184V probably benign Het
Gm9894 T C 13: 67,763,835 noncoding transcript Het
Gpd2 T A 2: 57,364,513 N674K probably benign Het
H2-M10.6 A G 17: 36,813,067 Y141C probably damaging Het
Heatr5a C T 12: 51,884,327 E1796K probably benign Het
Hexim2 A G 11: 103,138,292 T57A probably benign Het
Hrg A T 16: 22,954,518 N134Y probably damaging Het
Hsd17b12 T C 2: 94,033,977 T262A probably damaging Het
Irak3 G T 10: 120,143,137 P470T probably damaging Het
Itgbl1 A T 14: 123,846,565 D285V probably damaging Het
Klhdc7b T A 15: 89,388,386 M1157K probably damaging Het
Mdc1 G A 17: 35,848,633 G635D probably benign Het
Mdc1 A G 17: 35,857,572 K1690R probably benign Het
Mpp3 A T 11: 102,018,539 probably benign Het
Ncor2 G T 5: 125,020,011 H2285N probably benign Het
Neb T A 2: 52,257,827 T2727S probably benign Het
Nkx6-2 T C 7: 139,581,567 D234G possibly damaging Het
Nlrp9c T C 7: 26,384,725 I476M probably benign Het
Nrsn1 T G 13: 25,253,372 Q191P probably damaging Het
Olfr116 A T 17: 37,623,967 S223T possibly damaging Het
Olfr390 C T 11: 73,787,552 L205F probably benign Het
Olfr610 T A 7: 103,506,799 H49L probably benign Het
Patl1 T G 19: 11,937,354 L623R probably damaging Het
Pdc T C 1: 150,333,366 I200T probably benign Het
Pdzk1 A G 3: 96,868,426 D370G probably benign Het
Pglyrp3 A T 3: 92,031,534 I339F probably damaging Het
Plxnb1 T C 9: 109,116,611 V2070A probably damaging Het
Poln G A 5: 34,109,431 R461C probably damaging Het
Prl2b1 C A 13: 27,383,508 V218L probably damaging Het
Pygl T C 12: 70,216,654 D55G probably damaging Het
Rif1 C G 2: 52,095,844 L614V probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
RP24-351P7.8 T C 7: 11,610,301 F62S probably damaging Het
Rsrp1 T C 4: 134,924,381 F152S probably damaging Het
Sim2 T C 16: 94,097,251 S115P probably damaging Het
Slc17a1 T A 13: 23,875,610 I108K possibly damaging Het
Slc30a8 A G 15: 52,325,658 D223G probably damaging Het
Slc39a4 A T 15: 76,616,142 N69K probably benign Het
Slc51a T G 16: 32,479,766 T58P probably damaging Het
Slc7a14 T C 3: 31,224,112 H448R probably benign Het
Smc3 G A 19: 53,625,163 probably null Het
Sox6 A T 7: 115,486,628 D659E probably damaging Het
Stard9 GCCC GCC 2: 120,693,715 probably null Het
Tsr1 C T 11: 74,900,293 probably null Het
Ttc12 T C 9: 49,443,122 K565E probably damaging Het
Ube4b A T 4: 149,368,311 V386E probably benign Het
Ush2a T A 1: 188,728,096 probably null Het
Usp5 C A 6: 124,817,613 probably benign Het
Vmn1r216 T C 13: 23,099,935 F263L probably benign Het
Vmn2r88 T A 14: 51,418,149 L606* probably null Het
Wee2 T A 6: 40,449,620 probably null Het
Zfhx3 T C 8: 108,792,527 Y94H probably damaging Het
Zfp385c G A 11: 100,632,768 P120L probably benign Het
Other mutations in Kcp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00474:Kcp APN 6 29482657 missense probably benign
IGL01344:Kcp APN 6 29498951 splice site probably null
IGL01404:Kcp APN 6 29496639 missense probably damaging 0.99
IGL01735:Kcp APN 6 29498879 missense probably damaging 1.00
IGL01776:Kcp APN 6 29497908 missense probably damaging 1.00
IGL02092:Kcp APN 6 29489032 critical splice donor site probably null
IGL02252:Kcp APN 6 29504549 missense probably damaging 1.00
IGL02690:Kcp APN 6 29484999 unclassified probably benign
IGL02817:Kcp APN 6 29496969 missense probably damaging 0.97
IGL03074:Kcp APN 6 29496631 missense probably damaging 1.00
P0045:Kcp UTSW 6 29498348 missense probably damaging 1.00
R0219:Kcp UTSW 6 29495785 missense probably damaging 1.00
R0355:Kcp UTSW 6 29496927 missense possibly damaging 0.89
R0738:Kcp UTSW 6 29490439 missense probably benign 0.24
R1111:Kcp UTSW 6 29485423 missense probably benign
R1304:Kcp UTSW 6 29501292 unclassified probably benign
R1663:Kcp UTSW 6 29498965 missense possibly damaging 0.68
R1808:Kcp UTSW 6 29505655 missense probably benign 0.05
R1907:Kcp UTSW 6 29497835 unclassified probably benign
R2030:Kcp UTSW 6 29489072 missense probably damaging 1.00
R2099:Kcp UTSW 6 29496165 nonsense probably null
R3411:Kcp UTSW 6 29482846 missense possibly damaging 0.68
R3982:Kcp UTSW 6 29484637 missense probably damaging 1.00
R3983:Kcp UTSW 6 29484637 missense probably damaging 1.00
R4223:Kcp UTSW 6 29482258 missense possibly damaging 0.55
R4377:Kcp UTSW 6 29493203 missense probably damaging 1.00
R4570:Kcp UTSW 6 29491848 nonsense probably null
R4624:Kcp UTSW 6 29482814 missense possibly damaging 0.94
R4694:Kcp UTSW 6 29493197 missense probably benign 0.29
R4750:Kcp UTSW 6 29484626 missense probably benign 0.03
R4968:Kcp UTSW 6 29497629 nonsense probably null
R5053:Kcp UTSW 6 29496958 missense probably benign 0.01
R5067:Kcp UTSW 6 29492108 missense probably benign 0.06
R5253:Kcp UTSW 6 29498520 unclassified probably benign
R5418:Kcp UTSW 6 29504284 nonsense probably null
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6033:Kcp UTSW 6 29493194 missense probably damaging 1.00
R6088:Kcp UTSW 6 29502632 missense probably benign
R6178:Kcp UTSW 6 29482888 missense possibly damaging 0.68
R6285:Kcp UTSW 6 29502365 missense probably benign 0.21
R6310:Kcp UTSW 6 29493258 missense probably damaging 0.98
R6369:Kcp UTSW 6 29484694 missense probably damaging 1.00
R6860:Kcp UTSW 6 29505720 missense probably benign 0.19
R6949:Kcp UTSW 6 29484612 splice site probably null
R6962:Kcp UTSW 6 29482840 missense probably benign 0.08
R7006:Kcp UTSW 6 29499170 missense probably damaging 1.00
R7138:Kcp UTSW 6 29491862 nonsense probably null
R7141:Kcp UTSW 6 29487512 nonsense probably null
R7153:Kcp UTSW 6 29499015 missense probably damaging 1.00
R7162:Kcp UTSW 6 29497200 intron probably null
R7334:Kcp UTSW 6 29485512 missense probably damaging 1.00
R7565:Kcp UTSW 6 29499187 missense probably damaging 1.00
R7671:Kcp UTSW 6 29496517 missense probably benign 0.02
R7766:Kcp UTSW 6 29496847 missense probably damaging 0.98
R7781:Kcp UTSW 6 29497765 missense probably damaging 1.00
Z1176:Kcp UTSW 6 29485012 missense probably benign 0.23
Z1177:Kcp UTSW 6 29485525 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- AAGAAACTAGACCCTTCCTGGTG -3'
(R):5'- AGAACTAGGGTCTAGCCTCTG -3'

Sequencing Primer
(F):5'- CTTCATATTCACAGCCTGGAAGG -3'
(R):5'- TAGGGTCTAGCCTCTGCCACTG -3'
Posted On2017-06-26