Mutagenetix > Incidental Mutation

Incidental Mutation 'R6020:Zfhx3'

478869

Institutional Source

Beutler Lab

Gene Symbol

Zfhx3

Ensembl Gene

ENSMUSG00000038872

Gene Name

zinc finger homeobox 3

Synonyms

A230102L03Rik, Atbf1, WBP9

Accession Numbers

Genbank: NM_007496

Essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R6020 (G1)

Quality Score

218.009

Status

Not validated

Chromosome

Chromosomal Location

107942644-108961630 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108792527 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 94 (Y94H)

Ref Sequence

ENSEMBL: ENSMUSP00000152353 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043896] [ENSMUST00000188994] [ENSMUST00000220518]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000043896
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000044612
Gene: ENSMUSG00000038872
AA Change: Y94H

Domain	Start	End	E-Value	Type
ZnF_C2H2	79	103	7.89e0	SMART
low complexity region	110	127	N/A	INTRINSIC
low complexity region	148	165	N/A	INTRINSIC
ZnF_C2H2	282	305	1.36e1	SMART
low complexity region	393	411	N/A	INTRINSIC
coiled coil region	453	496	N/A	INTRINSIC
low complexity region	500	523	N/A	INTRINSIC
ZnF_C2H2	641	664	3.47e0	SMART
ZnF_C2H2	672	695	6.78e-3	SMART
ZnF_U1	724	758	5.71e-1	SMART
ZnF_C2H2	727	751	4.87e-4	SMART
low complexity region	771	785	N/A	INTRINSIC
low complexity region	796	804	N/A	INTRINSIC
ZnF_C2H2	805	829	6.67e-2	SMART
ZnF_U1	982	1016	2.35e0	SMART
ZnF_C2H2	985	1009	4.57e0	SMART
ZnF_C2H2	1041	1065	3.99e0	SMART
ZnF_U1	1086	1120	1.36e0	SMART
ZnF_C2H2	1089	1113	1.33e-1	SMART
ZnF_C2H2	1233	1256	4.11e-2	SMART
ZnF_C2H2	1262	1285	4.34e-1	SMART
ZnF_C2H2	1370	1395	1.08e-1	SMART
ZnF_C2H2	1411	1433	3.34e-2	SMART
ZnF_C2H2	1439	1462	8.09e-1	SMART
low complexity region	1500	1512	N/A	INTRINSIC
ZnF_U1	1552	1586	1.05e0	SMART
ZnF_C2H2	1555	1579	8.22e-2	SMART
ZnF_U1	1603	1637	4.19e0	SMART
ZnF_C2H2	1606	1630	1.16e-1	SMART
low complexity region	1643	1669	N/A	INTRINSIC
low complexity region	1734	1776	N/A	INTRINSIC
low complexity region	1792	1802	N/A	INTRINSIC
low complexity region	1842	1878	N/A	INTRINSIC
low complexity region	1881	1894	N/A	INTRINSIC
low complexity region	1967	1985	N/A	INTRINSIC
ZnF_C2H2	1990	2013	1.62e0	SMART
low complexity region	2041	2088	N/A	INTRINSIC
low complexity region	2110	2125	N/A	INTRINSIC
HOX	2152	2214	1.13e-16	SMART
HOX	2249	2311	2.41e-20	SMART
ZnF_C2H2	2335	2355	1.72e1	SMART
low complexity region	2383	2414	N/A	INTRINSIC
low complexity region	2458	2473	N/A	INTRINSIC
low complexity region	2476	2521	N/A	INTRINSIC
ZnF_C2H2	2539	2561	1.79e-2	SMART
low complexity region	2606	2619	N/A	INTRINSIC
HOX	2650	2712	2.97e-20	SMART
ZnF_C2H2	2720	2743	7.67e-2	SMART
low complexity region	2929	2950	N/A	INTRINSIC
HOX	2954	3016	1.07e-17	SMART
ZnF_U1	3029	3063	1.8e-1	SMART
ZnF_C2H2	3032	3056	8.31e0	SMART
low complexity region	3130	3144	N/A	INTRINSIC
low complexity region	3181	3235	N/A	INTRINSIC
low complexity region	3237	3256	N/A	INTRINSIC
low complexity region	3268	3282	N/A	INTRINSIC
low complexity region	3290	3299	N/A	INTRINSIC
coiled coil region	3362	3417	N/A	INTRINSIC
low complexity region	3452	3476	N/A	INTRINSIC
ZnF_C2H2	3489	3509	1.45e2	SMART
ZnF_U1	3546	3580	1.36e0	SMART
ZnF_C2H2	3549	3573	1.77e1	SMART
low complexity region	3602	3633	N/A	INTRINSIC
low complexity region	3642	3674	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000188994

Predicted Effect

probably damaging
Transcript: ENSMUST00000220518
AA Change: Y94H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.8%
20x: 93.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcription factor with multiple homeodomains and zinc finger motifs, and regulates myogenic and neuronal differentiation. The encoded protein suppresses expression of the alpha-fetoprotein gene by binding to an AT-rich enhancer motif. The protein has also been shown to negatively regulate c-Myb, and transactivate the cell cycle inhibitor cyclin-dependent kinase inhibitor 1A (also known as p21CIP1). This gene is reported to function as a tumor suppressor in several cancers, and sequence variants of this gene are also associated with atrial fibrillation. Multiple transcript variants expressed from alternate promoters and encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit normal initial pituitary development but reduced GH and TSH-beta staining within the pituitary by E17.5. Mice homozygous for a knock-out allele exhibit prenatal lethality. Mice heterozygous for the same allele exhibit partial postnatal lethality, decreased body size and prolonged conception time. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 76 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca9	C	A	11: 110,145,613	V557F	possibly damaging	Het
Abi3	A	T	11: 95,842,025	L41*	probably null	Het
Actn1	C	A	12: 80,174,455		probably null	Het
Adamts15	G	T	9: 30,902,062	R936S	probably benign	Het
Angel2	T	C	1: 190,932,871	S22P	probably benign	Het
Ank2	T	G	3: 126,946,821		probably benign	Het
Astn1	A	G	1: 158,509,993	D423G	probably damaging	Het
Casp9	A	G	4: 141,796,538	D78G	probably damaging	Het
Cbr4	A	G	8: 61,487,853	D2G	probably benign	Het
Ccdc8	T	A	7: 16,996,581	L665H	probably damaging	Het
Cdh23	T	A	10: 60,331,326	N1847I	probably damaging	Het
Cnst	T	C	1: 179,609,875	W335R	probably benign	Het
Ddr2	T	A	1: 170,005,102	I130F	probably benign	Het
Dnah2	C	T	11: 69,500,839	A677T	probably benign	Het
Dzip3	C	A	16: 48,951,842	W488L	probably damaging	Het
Ephb3	T	G	16: 21,222,013	I637S	probably damaging	Het
Etv3	A	G	3: 87,529,364	D142G	probably benign	Het
Fabp5	C	T	3: 10,016,089	T126I	probably benign	Het
Fam13b	A	C	18: 34,494,774	Y125D	probably damaging	Het
Fsip2	C	A	2: 82,992,127	P6068Q	probably damaging	Het
Gm11232	A	G	4: 71,756,668	F199S	possibly damaging	Het
Gm340	G	A	19: 41,583,547	G247D	possibly damaging	Het
Gm5493	A	G	17: 22,748,061	K57E	probably benign	Het
Gm7334	A	G	17: 50,699,237	M184V	probably benign	Het
Gm9894	T	C	13: 67,763,835		noncoding transcript	Het
Gpd2	T	A	2: 57,364,513	N674K	probably benign	Het
H2-M10.6	A	G	17: 36,813,067	Y141C	probably damaging	Het
Heatr5a	C	T	12: 51,884,327	E1796K	probably benign	Het
Hexim2	A	G	11: 103,138,292	T57A	probably benign	Het
Hrg	A	T	16: 22,954,518	N134Y	probably damaging	Het
Hsd17b12	T	C	2: 94,033,977	T262A	probably damaging	Het
Irak3	G	T	10: 120,143,137	P470T	probably damaging	Het
Itgbl1	A	T	14: 123,846,565	D285V	probably damaging	Het
Kcp	A	T	6: 29,502,864	V164E	probably benign	Het
Klhdc7b	T	A	15: 89,388,386	M1157K	probably damaging	Het
Mdc1	G	A	17: 35,848,633	G635D	probably benign	Het
Mdc1	A	G	17: 35,857,572	K1690R	probably benign	Het
Mpp3	A	T	11: 102,018,539		probably benign	Het
Ncor2	G	T	5: 125,020,011	H2285N	probably benign	Het
Neb	T	A	2: 52,257,827	T2727S	probably benign	Het
Nkx6-2	T	C	7: 139,581,567	D234G	possibly damaging	Het
Nlrp9c	T	C	7: 26,384,725	I476M	probably benign	Het
Nrsn1	T	G	13: 25,253,372	Q191P	probably damaging	Het
Olfr116	A	T	17: 37,623,967	S223T	possibly damaging	Het
Olfr390	C	T	11: 73,787,552	L205F	probably benign	Het
Olfr610	T	A	7: 103,506,799	H49L	probably benign	Het
Patl1	T	G	19: 11,937,354	L623R	probably damaging	Het
Pdc	T	C	1: 150,333,366	I200T	probably benign	Het
Pdzk1	A	G	3: 96,868,426	D370G	probably benign	Het
Pglyrp3	A	T	3: 92,031,534	I339F	probably damaging	Het
Plxnb1	T	C	9: 109,116,611	V2070A	probably damaging	Het
Poln	G	A	5: 34,109,431	R461C	probably damaging	Het
Prl2b1	C	A	13: 27,383,508	V218L	probably damaging	Het
Pygl	T	C	12: 70,216,654	D55G	probably damaging	Het
Rif1	C	G	2: 52,095,844	L614V	probably damaging	Het
Rnd2	C	T	11: 101,468,999	L57F	probably damaging	Het
RP24-351P7.8	T	C	7: 11,610,301	F62S	probably damaging	Het
Rsrp1	T	C	4: 134,924,381	F152S	probably damaging	Het
Sim2	T	C	16: 94,097,251	S115P	probably damaging	Het
Slc17a1	T	A	13: 23,875,610	I108K	possibly damaging	Het
Slc30a8	A	G	15: 52,325,658	D223G	probably damaging	Het
Slc39a4	A	T	15: 76,616,142	N69K	probably benign	Het
Slc51a	T	G	16: 32,479,766	T58P	probably damaging	Het
Slc7a14	T	C	3: 31,224,112	H448R	probably benign	Het
Smc3	G	A	19: 53,625,163		probably null	Het
Sox6	A	T	7: 115,486,628	D659E	probably damaging	Het
Stard9	GCCC	GCC	2: 120,693,715		probably null	Het
Tsr1	C	T	11: 74,900,293		probably null	Het
Ttc12	T	C	9: 49,443,122	K565E	probably damaging	Het
Ube4b	A	T	4: 149,368,311	V386E	probably benign	Het
Ush2a	T	A	1: 188,728,096		probably null	Het
Usp5	C	A	6: 124,817,613		probably benign	Het
Vmn1r216	T	C	13: 23,099,935	F263L	probably benign	Het
Vmn2r88	T	A	14: 51,418,149	L606*	probably null	Het
Wee2	T	A	6: 40,449,620		probably null	Het
Zfp385c	G	A	11: 100,632,768	P120L	probably benign	Het

Other mutations in Zfhx3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01011:Zfhx3	APN	8	108793594	missense	probably benign	0.00
IGL01946:Zfhx3	APN	8	108933929	missense	probably damaging	0.98
IGL01973:Zfhx3	APN	8	108947193	missense	probably damaging	1.00
IGL01983:Zfhx3	APN	8	108947234	missense	probably damaging	1.00
IGL02151:Zfhx3	APN	8	108793883	missense	probably damaging	1.00
IGL02405:Zfhx3	APN	8	108955742	missense	unknown
IGL02406:Zfhx3	APN	8	108955742	missense	unknown
IGL02408:Zfhx3	APN	8	108955372	splice site	probably benign
IGL02549:Zfhx3	APN	8	108800509	missense	probably damaging	1.00
IGL02601:Zfhx3	APN	8	108856830	missense	probably damaging	1.00
IGL02649:Zfhx3	APN	8	108793535	missense	possibly damaging	0.94
IGL03027:Zfhx3	APN	8	108793188	missense	probably damaging	0.98
IGL03053:Zfhx3	APN	8	108946500	missense	probably damaging	0.99
IGL03168:Zfhx3	APN	8	108946500	missense	probably damaging	0.99
IGL03194:Zfhx3	APN	8	108794727	missense	probably damaging	0.97
IGL03248:Zfhx3	APN	8	108946550	missense	probably damaging	1.00
FR4449:Zfhx3	UTSW	8	108956094	small insertion	probably benign
FR4589:Zfhx3	UTSW	8	108956101	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956088	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956102	small insertion	probably benign
FR4737:Zfhx3	UTSW	8	108956103	small insertion	probably benign
G5030:Zfhx3	UTSW	8	108951459	missense	possibly damaging	0.86
R0016:Zfhx3	UTSW	8	108950178	missense	probably benign	0.02
R0090:Zfhx3	UTSW	8	108950057	missense	possibly damaging	0.85
R0330:Zfhx3	UTSW	8	108948957	missense	probably damaging	1.00
R0332:Zfhx3	UTSW	8	108946623	missense	probably damaging	1.00
R0398:Zfhx3	UTSW	8	108951246	missense	probably damaging	0.98
R0539:Zfhx3	UTSW	8	108800509	missense	probably damaging	1.00
R0546:Zfhx3	UTSW	8	108794187	missense	probably damaging	1.00
R0614:Zfhx3	UTSW	8	108948539	missense	probably benign	0.03
R0614:Zfhx3	UTSW	8	108948967	nonsense	probably null
R0653:Zfhx3	UTSW	8	108946808	missense	possibly damaging	0.95
R0718:Zfhx3	UTSW	8	108955650	missense	unknown
R0825:Zfhx3	UTSW	8	108949208	missense	probably damaging	0.99
R1143:Zfhx3	UTSW	8	108794411	missense	probably damaging	1.00
R1319:Zfhx3	UTSW	8	108933833	missense	probably damaging	0.99
R1347:Zfhx3	UTSW	8	108800698	splice site	probably benign
R1412:Zfhx3	UTSW	8	108914567	missense	possibly damaging	0.88
R1447:Zfhx3	UTSW	8	108948444	missense	probably benign	0.03
R1530:Zfhx3	UTSW	8	108948489	missense	probably damaging	1.00
R1745:Zfhx3	UTSW	8	108955862	missense	unknown
R1764:Zfhx3	UTSW	8	108951644	missense	probably benign	0.18
R1781:Zfhx3	UTSW	8	108793535	missense	probably benign	0.01
R1917:Zfhx3	UTSW	8	108956248	missense	unknown
R1956:Zfhx3	UTSW	8	108794142	missense	probably benign	0.02
R2049:Zfhx3	UTSW	8	108945177	missense	probably benign	0.01
R2196:Zfhx3	UTSW	8	108800253	missense	probably damaging	1.00
R3085:Zfhx3	UTSW	8	108956032	missense	unknown
R3765:Zfhx3	UTSW	8	108792762	missense	probably damaging	0.97
R4162:Zfhx3	UTSW	8	108956987	missense	unknown
R4243:Zfhx3	UTSW	8	108792320	missense	probably damaging	0.97
R4380:Zfhx3	UTSW	8	108956390	missense	unknown
R4433:Zfhx3	UTSW	8	108955637	missense	unknown
R4509:Zfhx3	UTSW	8	108793779	missense	probably benign	0.01
R4731:Zfhx3	UTSW	8	108956084	missense	unknown
R4788:Zfhx3	UTSW	8	108794210	missense	probably damaging	1.00
R4812:Zfhx3	UTSW	8	108947961	missense	possibly damaging	0.83
R4893:Zfhx3	UTSW	8	108957007	missense	unknown
R4907:Zfhx3	UTSW	8	108793354	missense	probably damaging	0.99
R4935:Zfhx3	UTSW	8	108947850	missense	possibly damaging	0.92
R4943:Zfhx3	UTSW	8	108948317	missense	probably damaging	0.98
R5154:Zfhx3	UTSW	8	108800575	missense	probably damaging	1.00
R5377:Zfhx3	UTSW	8	108951185	missense	possibly damaging	0.95
R5388:Zfhx3	UTSW	8	108946814	missense	possibly damaging	0.88
R5434:Zfhx3	UTSW	8	108792399	missense	probably damaging	0.99
R5445:Zfhx3	UTSW	8	108956210	missense	unknown
R5541:Zfhx3	UTSW	8	108948951	missense	probably damaging	0.99
R5571:Zfhx3	UTSW	8	108955991	missense	unknown
R5700:Zfhx3	UTSW	8	108933867	missense	probably damaging	1.00
R5754:Zfhx3	UTSW	8	108800332	missense	probably damaging	0.99
R5867:Zfhx3	UTSW	8	108793446	missense	probably damaging	1.00
R5905:Zfhx3	UTSW	8	108793503	missense	probably damaging	1.00
R5922:Zfhx3	UTSW	8	108946698	missense	probably damaging	1.00
R5972:Zfhx3	UTSW	8	108950851	missense	possibly damaging	0.91
R6028:Zfhx3	UTSW	8	108793503	missense	probably damaging	1.00
R6113:Zfhx3	UTSW	8	108947421	missense	probably benign	0.04
R6253:Zfhx3	UTSW	8	108955388	missense	possibly damaging	0.96
R6356:Zfhx3	UTSW	8	108946619	missense	probably damaging	1.00
R6800:Zfhx3	UTSW	8	108949517	missense	probably benign	0.20
R6829:Zfhx3	UTSW	8	108950283	missense	probably damaging	0.98
R6872:Zfhx3	UTSW	8	108800641	missense	probably damaging	1.00
R6873:Zfhx3	UTSW	8	108800641	missense	probably damaging	1.00
R6919:Zfhx3	UTSW	8	108800528	missense	probably damaging	1.00
R6921:Zfhx3	UTSW	8	108951392	missense	possibly damaging	0.53
R6925:Zfhx3	UTSW	8	108956821	missense	unknown
R6927:Zfhx3	UTSW	8	108956821	missense	unknown
R7152:Zfhx3	UTSW	8	108948207	missense	possibly damaging	0.94
R7169:Zfhx3	UTSW	8	108951398	missense	possibly damaging	0.86
R7214:Zfhx3	UTSW	8	108948861	missense	probably damaging	0.98
R7378:Zfhx3	UTSW	8	108793248	missense	probably damaging	0.99
R7391:Zfhx3	UTSW	8	108947843	missense	probably damaging	0.96
R7442:Zfhx3	UTSW	8	108792836	missense	probably damaging	0.97
R7636:Zfhx3	UTSW	8	108946809	missense	probably benign	0.25
R7649:Zfhx3	UTSW	8	108951644	missense	probably benign	0.18
R7699:Zfhx3	UTSW	8	108951122	missense	probably benign	0.18
R7728:Zfhx3	UTSW	8	108951569	missense	probably benign	0.01
R7780:Zfhx3	UTSW	8	108951651	missense	possibly damaging	0.53
R7904:Zfhx3	UTSW	8	108951063	missense	probably damaging	0.98
R8032:Zfhx3	UTSW	8	108951222	missense	possibly damaging	0.51
R8158:Zfhx3	UTSW	8	108948721	missense	possibly damaging	0.82
R8163:Zfhx3	UTSW	8	108949293	missense	probably damaging	1.00
R8215:Zfhx3	UTSW	8	108950717	missense	probably benign
R8217:Zfhx3	UTSW	8	108950717	missense	probably benign
R8218:Zfhx3	UTSW	8	108950717	missense	probably benign
R8369:Zfhx3	UTSW	8	108856816	missense	possibly damaging	0.82
R8424:Zfhx3	UTSW	8	108856753	missense	probably damaging	0.98
R8482:Zfhx3	UTSW	8	108947879	missense	probably benign	0.02
R8504:Zfhx3	UTSW	8	108856917	missense	possibly damaging	0.95
R8871:Zfhx3	UTSW	8	108950235	missense	possibly damaging	0.85
R9144:Zfhx3	UTSW	8	108950162	missense	possibly damaging	0.53
R9202:Zfhx3	UTSW	8	108951288	missense	possibly damaging	0.92
R9213:Zfhx3	UTSW	8	108950124	missense	probably benign	0.18
R9218:Zfhx3	UTSW	8	108793869	missense	probably benign	0.17
R9370:Zfhx3	UTSW	8	108794708	missense	probably damaging	1.00
R9422:Zfhx3	UTSW	8	108704218	start gained	probably benign
R9530:Zfhx3	UTSW	8	108800378	missense	probably damaging	1.00
RF027:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF028:Zfhx3	UTSW	8	108956096	small insertion	probably benign
RF029:Zfhx3	UTSW	8	108956092	small insertion	probably benign
RF031:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF032:Zfhx3	UTSW	8	108956092	small insertion	probably benign
RF037:Zfhx3	UTSW	8	108956098	nonsense	probably null
RF038:Zfhx3	UTSW	8	108956101	small insertion	probably benign
RF040:Zfhx3	UTSW	8	108956101	small insertion	probably benign
RF042:Zfhx3	UTSW	8	108956088	small insertion	probably benign
RF042:Zfhx3	UTSW	8	108956098	small insertion	probably benign
RF054:Zfhx3	UTSW	8	108956096	small insertion	probably benign
RF060:Zfhx3	UTSW	8	108956088	small insertion	probably benign
X0019:Zfhx3	UTSW	8	108951653	missense	probably benign	0.00
X0026:Zfhx3	UTSW	8	108949145	missense	probably damaging	1.00
Z1088:Zfhx3	UTSW	8	108951357	missense	possibly damaging	0.72
Z1176:Zfhx3	UTSW	8	108793923	missense	probably benign	0.09
Z1176:Zfhx3	UTSW	8	108800449	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CAAACCCAGTAGCATGGAGC -3'
(R):5'- TGATGATCTGCGGGTACACG -3'

Sequencing Primer
(F):5'- ATGGAGCAGCCCACAGG -3'
(R):5'- ACCCCTGGGAGAGAGTTCAG -3'

Posted On

2017-06-26